Transcript: Human XM_024446095.1

PREDICTED: Homo sapiens cyclin dependent kinase like 3 (CDKL3), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDKL3 (51265)
Length:
2499
CDS:
870..2246

Additional Resources:

NCBI RefSeq record:
XM_024446095.1
NBCI Gene record:
CDKL3 (51265)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446095.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314924 TGACTATCTTCACAGTAATAA pLKO_005 1208 CDS 100% 15.000 21.000 N CDKL3 n/a
2 TRCN0000356141 GTTACGGAACAGTCATGAAAT pLKO_005 910 CDS 100% 13.200 18.480 N CDKL3 n/a
3 TRCN0000314995 TGGTATAGAGCTCCCGAATTA pLKO_005 1362 CDS 100% 13.200 18.480 N CDKL3 n/a
4 TRCN0000356108 ACTAGAGAGTAAGCGACTTAG pLKO_005 1157 CDS 100% 10.800 15.120 N CDKL3 n/a
5 TRCN0000314926 ATAGTGGCCATTAAGATATTT pLKO_005 954 CDS 100% 15.000 10.500 N CDKL3 n/a
6 TRCN0000314925 GATTTGGATTTACTCCATAAA pLKO_005 1521 CDS 100% 13.200 9.240 N CDKL3 n/a
7 TRCN0000195070 CTTTGGGCTGTATGATCATTG pLKO.1 1462 CDS 100% 10.800 7.560 N CDKL3 n/a
8 TRCN0000195206 CCAGAACAATCTGTCAACAAA pLKO.1 984 CDS 100% 5.625 3.938 N CDKL3 n/a
9 TRCN0000002376 CACACAGTATTAGATGAGTTA pLKO.1 1119 CDS 100% 4.950 3.465 N CDKL3 n/a
10 TRCN0000194700 CAGGATATCATCTAGTGATCT pLKO.1 1724 CDS 100% 4.950 3.465 N CDKL3 n/a
11 TRCN0000314927 ATGGATTGTTGGCAGATATAG pLKO_005 1672 CDS 100% 13.200 7.920 N CDKL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446095.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489746 AGCGACCGACGTAAGGTACTCGAG pLX_317 27.6% 72.6% 63.9% V5 (many diffs) n/a
2 TRCN0000489363 GTTGGTTGTTCTCCAAGACAACGT pLX_317 30.3% 72.5% 64% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_03262 pDONR223 100% 67.2% 64.9% None (many diffs) n/a
4 ccsbBroad304_03262 pLX_304 0% 67.2% 64.9% V5 (many diffs) n/a
5 ccsbBroadEn_15062 pDONR223 0% 67.2% 64.9% None (many diffs) n/a
6 ccsbBroad304_15062 pLX_304 0% 67.2% 64.9% V5 (many diffs) n/a
7 TRCN0000473541 CGACATTCATACACCTACACCTGC pLX_317 21.4% 67.2% 64.9% V5 (many diffs) n/a
Download CSV