Transcript: Human XM_024447890.1

PREDICTED: Homo sapiens fibroblast growth factor receptor 2 (FGFR2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FGFR2 (2263)
Length:
4322
CDS:
591..2849

Additional Resources:

NCBI RefSeq record:
XM_024447890.1
NBCI Gene record:
FGFR2 (2263)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148071 GCCGGCAAATGCCTCCACAG pXPR_003 TGG 592 26% 6 0.5703 FGFR2 FGFR2 76182
2 BRDN0001147365 GATAGCCATTTACTGCATAG pXPR_003 GGG 940 42% 8 0.5052 FGFR2 FGFR2 76183
3 BRDN0001149360 TGTGTCTGTTCTAGCACTCG pXPR_003 GGG 732 32% 7 0.0213 FGFR2 FGFR2 76184
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219679 TTAGTTGAGGATACCACATTA pLKO.1 726 CDS 100% 13.200 18.480 N FGFR2 n/a
2 TRCN0000231051 TTAGTTGAGGATACCACATTA pLKO_005 726 CDS 100% 13.200 18.480 N FGFR2 n/a
3 TRCN0000000368 CCGAATGAAGAACACGACCAA pLKO.1 1577 CDS 100% 2.640 3.696 N FGFR2 n/a
4 TRCN0000194817 CGTTGTTCCTTCTGTACTAAA pLKO.1 4153 3UTR 100% 13.200 10.560 N FGFR2 n/a
5 TRCN0000218493 AGCCCTGTTTGATAGAGTATA pLKO_005 2402 CDS 100% 13.200 9.240 N FGFR2 n/a
6 TRCN0000231053 ATATGGATCAGAGGAGTAAAT pLKO_005 2950 3UTR 100% 13.200 9.240 N FGFR2 n/a
7 TRCN0000321949 ATATGGATCAGAGGAGTAAAT pLKO_005 2950 3UTR 100% 13.200 9.240 N Fgfr2 n/a
8 TRCN0000000370 GCCAACCTCTCGAACAGTATT pLKO.1 2701 CDS 100% 13.200 9.240 N FGFR2 n/a
9 TRCN0000219680 TGGAGTACTCCTATGACATTA pLKO.1 2134 CDS 100% 13.200 9.240 N FGFR2 n/a
10 TRCN0000257217 TGGAGTACTCCTATGACATTA pLKO_005 2134 CDS 100% 13.200 9.240 N FGFR2 n/a
11 TRCN0000321950 TGGAGTACTCCTATGACATTA pLKO_005 2134 CDS 100% 13.200 9.240 N Fgfr2 n/a
12 TRCN0000000366 GCACACACTTACAGAGCACAA pLKO.1 3193 3UTR 100% 4.050 2.835 N FGFR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06211 pDONR223 100% 90.2% 90% None (many diffs) n/a
2 ccsbBroad304_06211 pLX_304 0% 90.2% 90% V5 (many diffs) n/a
3 ccsbBroadEn_14640 pDONR223 0% 87.1% 87.1% None 1_57del;164_165ins267 n/a
4 ccsbBroad304_14640 pLX_304 0% 87.1% 87.1% V5 1_57del;164_165ins267 n/a
5 TRCN0000465402 CTAGCGAGATACATAGTTCGCTAC pLX_317 9.6% 87.1% 87.1% V5 1_57del;164_165ins267 n/a
6 TRCN0000488178 TTTGGGGCAGTGGTGCCCTACGGC pLX_317 9.8% 87.1% 87.1% V5 (not translated due to prior stop codon) 1_57del;164_165ins267;486A>G n/a
7 TRCN0000489718 CGCCACTACCTCAGAATTGCTGAT pLX_317 16.4% 87% 87% V5 (many diffs) n/a
8 TRCN0000491520 TTTCTTCGCCTCATCTCCCTTGTC pLX_317 7.9% 83.8% 83.7% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000492076 ACTGTTTAAGGCTAGTTTATGATC pLX_317 16.5% 83.8% 83.6% V5 (many diffs) n/a
10 TRCN0000491431 CTCACCCCTTCATGGGAGAACTCG pLX_317 12.9% 81.2% 79.5% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000487708 AAGTTCAAGTCTTTTTGTAGGCCG pLX_317 15.7% 51% 51% V5 (not translated due to prior stop codon) 1_1104del n/a
Download CSV