Transcript: Human XM_024449808.1

PREDICTED: Homo sapiens golgin A8 family member F (GOLGA8F), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOLGA8F (100132565)
Length:
2487
CDS:
63..2072

Additional Resources:

NCBI RefSeq record:
XM_024449808.1
NBCI Gene record:
GOLGA8F (100132565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152236 CAGTTGAAGGAGTCACTTAAA pLKO.1 777 CDS 100% 13.200 6.600 Y GOLGA8EP n/a
2 TRCN0000151329 GAGATGCCATCAGAAAGTTTA pLKO.1 1622 CDS 100% 13.200 6.600 Y GOLGA8F n/a
3 TRCN0000269218 CAGTTGGAGCAGCAAGTAAAG pLKO_005 1257 CDS 100% 10.800 5.400 Y GOLGA6L9 n/a
4 TRCN0000195845 CCCACAAGCATGGTGATCTTT pLKO.1 1873 CDS 100% 5.625 2.813 Y GOLGA8EP n/a
5 TRCN0000153701 CAAGGAGCTGAACAATGAGAA pLKO.1 1223 CDS 100% 4.950 2.475 Y GOLGA8G n/a
6 TRCN0000158108 CAGAGAGAGATGCCATCAGAA pLKO.1 1616 CDS 100% 4.950 2.475 Y GOLGA8G n/a
7 TRCN0000157310 CAGCGCATAAGTCTCCTGAAT pLKO.1 1089 CDS 100% 4.950 2.475 Y GOLGA8G n/a
8 TRCN0000158334 CTACAGTTGGAGCAGCAAGTA pLKO.1 1254 CDS 100% 4.950 2.475 Y GOLGA8G n/a
9 TRCN0000157512 GCTCGTTGAAGAAGGAGAAGA pLKO.1 892 CDS 100% 4.950 2.475 Y GOLGA8F n/a
10 TRCN0000153184 GTGGGAGTTCAAACACACAAA pLKO.1 2351 3UTR 100% 4.950 2.475 Y GOLGA8F n/a
11 TRCN0000157882 CTCAAACACCAGATGGCTGAA pLKO.1 960 CDS 100% 4.050 2.025 Y GOLGA8G n/a
12 TRCN0000152781 GAGAGGGATGAATATGCTGAA pLKO.1 810 CDS 100% 4.050 2.025 Y GOLGA8G n/a
13 TRCN0000153085 GCAACATTCATTGCAGCGTAA pLKO.1 608 CDS 100% 4.050 2.025 Y GOLGA8IP n/a
14 TRCN0000150773 GCATGATAAATATCGGGTAGA pLKO.1 914 CDS 100% 4.050 2.025 Y GOLGA8G n/a
15 TRCN0000152577 GTCCAAACTCAAACACCAGAT pLKO.1 953 CDS 100% 4.050 2.025 Y GOLGA8G n/a
16 TRCN0000153484 CACAGCAAATTCTTGGTGACT pLKO.1 1791 CDS 100% 2.640 1.320 Y GOLGA8F n/a
17 TRCN0000154849 GAACAGCTTCAAGGAGCTGAA pLKO.1 1214 CDS 100% 0.405 0.203 Y GOLGA8EP n/a
18 TRCN0000152586 GACACAGTTGAAGGAGTCATT pLKO.1 773 CDS 100% 4.950 2.475 Y GOLGA8IP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07828 pDONR223 100% 77.8% 67.5% None (many diffs) n/a
2 ccsbBroad304_07828 pLX_304 0% 77.8% 67.5% V5 (many diffs) n/a
3 TRCN0000477056 CCAAAGGCACCTCCGCCCTGATCT pLX_317 21.8% 77.8% 67.5% V5 (many diffs) n/a
4 ccsbBroadEn_10341 pDONR223 100% 64.2% 64.2% None 1_654del;1407_1469del n/a
5 ccsbBroad304_10341 pLX_304 0% 64.2% 64.2% V5 1_654del;1407_1469del n/a
6 TRCN0000476380 AGTGATAACGTTCAAGGTCGCGGA pLX_317 28.7% 64.2% 64.2% V5 1_654del;1407_1469del n/a
7 ccsbBroadEn_16170 pDONR223 0% 63.6% 63.2% None (many diffs) n/a
8 ccsbBroad304_16170 pLX_304 0% 63.6% 63.2% V5 (many diffs) n/a
9 ccsbBroadEn_16172 pDONR223 0% 42.3% 42.3% None 1_654del;1014_1517del n/a
10 ccsbBroad304_16172 pLX_304 0% 42.3% 42.3% V5 1_654del;1014_1517del n/a
11 TRCN0000480289 TACTAACTTATTTTTTGACAAACC pLX_317 100% 9.6% 9.5% V5 (not translated due to prior stop codon) 1_654del;848_2007del n/a
Download CSV