Transcript: Human XM_024449905.1

PREDICTED: Homo sapiens golgin A8 family member G (GOLGA8G), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOLGA8G (283768)
Length:
5027
CDS:
63..2069

Additional Resources:

NCBI RefSeq record:
XM_024449905.1
NBCI Gene record:
GOLGA8G (283768)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183650 CCACTCTTTGTGTAGATATTT pLKO.1 4279 3UTR 100% 15.000 7.500 Y GOLGA8EP n/a
2 TRCN0000152236 CAGTTGAAGGAGTCACTTAAA pLKO.1 774 CDS 100% 13.200 6.600 Y GOLGA8EP n/a
3 TRCN0000153758 CCACCAAGAGTACTGACATTT pLKO.1 2581 3UTR 100% 13.200 6.600 Y GOLGA8F n/a
4 TRCN0000151329 GAGATGCCATCAGAAAGTTTA pLKO.1 1619 CDS 100% 13.200 6.600 Y GOLGA8F n/a
5 TRCN0000269218 CAGTTGGAGCAGCAAGTAAAG pLKO_005 1254 CDS 100% 10.800 5.400 Y GOLGA6L9 n/a
6 TRCN0000195845 CCCACAAGCATGGTGATCTTT pLKO.1 1870 CDS 100% 5.625 2.813 Y GOLGA8EP n/a
7 TRCN0000151177 GCAAGATAGAGTGTGTTTCAT pLKO.1 2737 3UTR 100% 5.625 2.813 Y GOLGA8F n/a
8 TRCN0000153167 GCCTATGTTCTGCTGTTGTTT pLKO.1 2475 3UTR 100% 5.625 2.813 Y GOLGA8G n/a
9 TRCN0000153701 CAAGGAGCTGAACAATGAGAA pLKO.1 1220 CDS 100% 4.950 2.475 Y GOLGA8G n/a
10 TRCN0000158108 CAGAGAGAGATGCCATCAGAA pLKO.1 1613 CDS 100% 4.950 2.475 Y GOLGA8G n/a
11 TRCN0000157310 CAGCGCATAAGTCTCCTGAAT pLKO.1 1086 CDS 100% 4.950 2.475 Y GOLGA8G n/a
12 TRCN0000154302 CCTCTGTTCATGGAGCTTCTT pLKO.1 3174 3UTR 100% 4.950 2.475 Y GOLGA8EP n/a
13 TRCN0000158334 CTACAGTTGGAGCAGCAAGTA pLKO.1 1251 CDS 100% 4.950 2.475 Y GOLGA8G n/a
14 TRCN0000151328 GCCTGTGGATTAAATCACATA pLKO.1 4199 3UTR 100% 4.950 2.475 Y GOLGA8G n/a
15 TRCN0000157512 GCTCGTTGAAGAAGGAGAAGA pLKO.1 889 CDS 100% 4.950 2.475 Y GOLGA8F n/a
16 TRCN0000153060 GCTTCAGCAGTTGTACTCTTT pLKO.1 2847 3UTR 100% 4.950 2.475 Y GOLGA8F n/a
17 TRCN0000153184 GTGGGAGTTCAAACACACAAA pLKO.1 2348 3UTR 100% 4.950 2.475 Y GOLGA8F n/a
18 TRCN0000157882 CTCAAACACCAGATGGCTGAA pLKO.1 957 CDS 100% 4.050 2.025 Y GOLGA8G n/a
19 TRCN0000152781 GAGAGGGATGAATATGCTGAA pLKO.1 807 CDS 100% 4.050 2.025 Y GOLGA8G n/a
20 TRCN0000153085 GCAACATTCATTGCAGCGTAA pLKO.1 608 CDS 100% 4.050 2.025 Y GOLGA8IP n/a
21 TRCN0000150773 GCATGATAAATATCGGGTAGA pLKO.1 911 CDS 100% 4.050 2.025 Y GOLGA8G n/a
22 TRCN0000152577 GTCCAAACTCAAACACCAGAT pLKO.1 950 CDS 100% 4.050 2.025 Y GOLGA8G n/a
23 TRCN0000151149 GCTGTACTATTGTAGTTCCTT pLKO.1 2781 3UTR 100% 3.000 1.500 Y GOLGA8F n/a
24 TRCN0000153484 CACAGCAAATTCTTGGTGACT pLKO.1 1788 CDS 100% 2.640 1.320 Y GOLGA8F n/a
25 TRCN0000151983 CCTCACAAACTTCTTTGTGAA pLKO.1 3515 3UTR 100% 0.495 0.248 Y GOLGA8EP n/a
26 TRCN0000154849 GAACAGCTTCAAGGAGCTGAA pLKO.1 1211 CDS 100% 0.405 0.203 Y GOLGA8EP n/a
27 TRCN0000152586 GACACAGTTGAAGGAGTCATT pLKO.1 770 CDS 100% 4.950 2.475 Y GOLGA8IP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07828 pDONR223 100% 77.9% 67.6% None (many diffs) n/a
2 ccsbBroad304_07828 pLX_304 0% 77.9% 67.6% V5 (many diffs) n/a
3 TRCN0000477056 CCAAAGGCACCTCCGCCCTGATCT pLX_317 21.8% 77.9% 67.6% V5 (many diffs) n/a
4 ccsbBroadEn_10341 pDONR223 100% 64.3% 64.3% None 1_651del;1404_1466del n/a
5 ccsbBroad304_10341 pLX_304 0% 64.3% 64.3% V5 1_651del;1404_1466del n/a
6 TRCN0000476380 AGTGATAACGTTCAAGGTCGCGGA pLX_317 28.7% 64.3% 64.3% V5 1_651del;1404_1466del n/a
7 ccsbBroadEn_16170 pDONR223 0% 63.7% 63.3% None (many diffs) n/a
8 ccsbBroad304_16170 pLX_304 0% 63.7% 63.3% V5 (many diffs) n/a
9 ccsbBroadEn_16172 pDONR223 0% 42.3% 42.3% None 1_651del;1011_1514del n/a
10 ccsbBroad304_16172 pLX_304 0% 42.3% 42.3% V5 1_651del;1011_1514del n/a
11 TRCN0000480289 TACTAACTTATTTTTTGACAAACC pLX_317 100% 9.6% 9.5% V5 (not translated due to prior stop codon) 1_651del;845_2004del n/a
Download CSV