Transcript: Human XM_024451145.1

PREDICTED: Homo sapiens tubulin beta 8B (TUBB8B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TUBB8B (260334)
Length:
3143
CDS:
1752..2870

Additional Resources:

NCBI RefSeq record:
XM_024451145.1
NBCI Gene record:
TUBB8B (260334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116637 GCCACCTTCATTGGGAATAAT pLKO.1 2628 CDS 100% 15.000 7.500 Y TUBB8 n/a
2 TRCN0000116638 CCAGCAGATGTTTGATGCTAA pLKO.1 2405 CDS 100% 4.950 2.475 Y TUBB8 n/a
3 TRCN0000116876 GCATAGATAACGAAGCGCTAT pLKO.1 2137 CDS 100% 4.050 2.025 Y TUBB7P n/a
4 TRCN0000116640 CCCAGCAGATGTTTGATGCTA pLKO.1 2404 CDS 100% 3.000 1.500 Y TUBB8 n/a
5 TRCN0000116641 GCCGTGAACATGGTCCCGTTT pLKO.1 2295 CDS 100% 1.350 0.675 Y TUBB8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02416 pDONR223 100% 74% 75.5% None (many diffs) n/a
2 ccsbBroad304_02416 pLX_304 0% 74% 75.5% V5 (many diffs) n/a
3 TRCN0000466709 TCTCGCAGGACAGTTCGGCCAACT pLX_317 32.4% 74% 75.5% V5 (many diffs) n/a
4 ccsbBroadEn_07109 pDONR223 100% 69.3% 73.5% None (many diffs) n/a
5 ccsbBroad304_07109 pLX_304 0% 69.3% 73.5% V5 (many diffs) n/a
6 TRCN0000470494 CAATTACAACATTCATCTATATAC pLX_317 29.5% 69.3% 73.5% V5 (many diffs) n/a
7 ccsbBroadEn_07591 pDONR223 100% 69% 74.5% None (many diffs) n/a
8 ccsbBroad304_07591 pLX_304 0% 69% 74.5% V5 (many diffs) n/a
9 TRCN0000472336 CCGGAACAAGTAAACTGCTTATCA pLX_317 41.4% 69% 74.5% V5 (many diffs) n/a
10 ccsbBroadEn_05511 pDONR223 100% 68.9% 73.7% None (many diffs) n/a
11 ccsbBroad304_05511 pLX_304 0% 68.9% 73.7% V5 (many diffs) n/a
12 TRCN0000478420 AGGACATGACATCGGGCAGTTTCG pLX_317 18.3% 68.9% 73.7% V5 (many diffs) n/a
13 ccsbBroadEn_02415 pDONR223 100% 67.6% 71.4% None (many diffs) n/a
14 ccsbBroad304_02415 pLX_304 0% 67.6% 71.4% V5 (many diffs) n/a
15 TRCN0000469802 TTTCCTGATTTATTTGACTTAATT pLX_317 33.2% 67.6% 71.4% V5 (many diffs) n/a
16 TRCN0000488922 TAACTAAGCCACAGTTTAACTCGA pLX_317 26.8% 67.6% 71.4% V5 (not translated due to prior stop codon) (many diffs) n/a
17 ccsbBroadEn_05206 pDONR223 100% 67.5% 74.3% None (many diffs) n/a
18 ccsbBroad304_05206 pLX_304 0% 67.5% 74.3% V5 (many diffs) n/a
Download CSV