Transcript: Human XM_024451399.1

PREDICTED: Homo sapiens zinc finger protein 320 (ZNF320), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF320 (162967)
Length:
922
CDS:
565..843

Additional Resources:

NCBI RefSeq record:
XM_024451399.1
NBCI Gene record:
ZNF320 (162967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021905 GACGTGATGCTGGAGAATTAT pLKO.1 667 CDS 100% 15.000 7.500 Y ZNF765 n/a
2 TRCN0000021906 CCCTGCTCAGAGGACTCTATA pLKO.1 642 CDS 100% 13.200 6.600 Y ZNF765 n/a
3 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 593 CDS 100% 5.625 2.813 Y ZNF765 n/a
4 TRCN0000021907 GCTGGAGAATTATAGGAACCT pLKO.1 675 CDS 100% 2.640 1.320 Y ZNF765 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14339 pDONR223 100% 57.8% 3.2% None (many diffs) n/a
2 ccsbBroad304_14339 pLX_304 0% 57.8% 3.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478280 ACGAGTTCACTGTCATGACCAACC pLX_317 100% 57.8% 3.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_08581 pDONR223 100% 15.9% 10.8% None (many diffs) n/a
5 ccsbBroad304_08581 pLX_304 0% 15.9% 10.8% V5 (many diffs) n/a
6 TRCN0000476486 AGTATTTAAATCGATGTCTATAAC pLX_317 30.4% 15.9% 10.8% V5 (many diffs) n/a
7 ccsbBroadEn_05120 pDONR223 100% 14.1% 11% None (many diffs) n/a
8 ccsbBroad304_05120 pLX_304 0% 14.1% 11% V5 (many diffs) n/a
9 TRCN0000475531 CGCGGTATGATTAGCATATCCGAT pLX_317 14.1% 14.1% 11% V5 (many diffs) n/a
Download CSV