Transcript: Human XM_024453187.1

PREDICTED: Homo sapiens histone acetyltransferase 1 (HAT1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HAT1 (8520)
Length:
4248
CDS:
2673..3914

Additional Resources:

NCBI RefSeq record:
XM_024453187.1
NBCI Gene record:
HAT1 (8520)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231310 GAAGCTACAGACTGGATATTA pLKO_005 3700 CDS 100% 15.000 21.000 N Hat1 n/a
2 TRCN0000034737 CCGTGTTGAATATGCATCTAA pLKO.1 2915 CDS 100% 5.625 7.875 N HAT1 n/a
3 TRCN0000306855 CCGTGTTGAATATGCATCTAA pLKO_005 2915 CDS 100% 5.625 7.875 N HAT1 n/a
4 TRCN0000034734 CGGCGTGTTATTGAACGACTT pLKO.1 3882 CDS 100% 4.050 5.670 N HAT1 n/a
5 TRCN0000289816 CGGCGTGTTATTGAACGACTT pLKO_005 3882 CDS 100% 4.050 5.670 N HAT1 n/a
6 TRCN0000034736 GCTACATGACAGTCTATAATT pLKO.1 3313 CDS 100% 15.000 10.500 N HAT1 n/a
7 TRCN0000289747 GCTACATGACAGTCTATAATT pLKO_005 3313 CDS 100% 15.000 10.500 N HAT1 n/a
8 TRCN0000231308 ATGTAGAGGCTTTCGAGAATA pLKO_005 3155 CDS 100% 13.200 9.240 N Hat1 n/a
9 TRCN0000034738 GCAAGGATTCAATGAAGATAT pLKO.1 3572 CDS 100% 13.200 9.240 N HAT1 n/a
10 TRCN0000289815 GCAAGGATTCAATGAAGATAT pLKO_005 3572 CDS 100% 13.200 9.240 N HAT1 n/a
11 TRCN0000034735 GCAGATGATGTTGAGGGCAAA pLKO.1 2964 CDS 100% 4.050 2.835 N HAT1 n/a
12 TRCN0000289746 GCAGATGATGTTGAGGGCAAA pLKO_005 2964 CDS 100% 4.050 2.835 N HAT1 n/a
13 TRCN0000039277 GCTAGCTTTATTGACGTGGAT pLKO.1 3219 CDS 100% 2.640 1.584 N Hat1 n/a
14 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 2416 5UTR 100% 4.950 2.475 Y RBM48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11277 pDONR223 100% 80.7% 80.6% None 1_237del;923T>C n/a
2 ccsbBroad304_11277 pLX_304 0% 80.7% 80.6% V5 1_237del;923T>C n/a
3 TRCN0000465718 TCGTTCTATACCCGCCGCTGGTTG pLX_317 9.4% 80.7% 80.6% V5 1_237del;923T>C n/a
4 ccsbBroadEn_15634 pDONR223 0% 43.2% 43% None 1_702del;923T>C n/a
5 ccsbBroad304_15634 pLX_304 0% 43.2% 43% V5 1_702del;923T>C n/a
6 TRCN0000472534 GTTAGCTAACGAGCGGGCCAGACG pLX_317 83.4% 43.2% 43% V5 1_702del;923T>C n/a
Download CSV