Transcript: Mouse XM_030243973.1

PREDICTED: Mus musculus pleckstrin homology like domain, family B, member 1 (Phldb1), transcript variant X24, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Phldb1 (102693)
Length:
5565
CDS:
146..4315

Additional Resources:

NCBI RefSeq record:
XM_030243973.1
NBCI Gene record:
Phldb1 (102693)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030243973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295457 TCACGGAGATCAGCGACAATG pLKO_005 1887 CDS 100% 10.800 15.120 N Phldb1 n/a
2 TRCN0000106004 CGAGGGCTACACTCAATTCAT pLKO.1 4288 CDS 100% 5.625 7.875 N Phldb1 n/a
3 TRCN0000288146 CGAGGGCTACACTCAATTCAT pLKO_005 4288 CDS 100% 5.625 7.875 N Phldb1 n/a
4 TRCN0000106002 CGCTCCAAGATGGATAGTGAT pLKO.1 3032 CDS 100% 4.950 6.930 N Phldb1 n/a
5 TRCN0000106003 GCCTGAGTGAATACCCATCTT pLKO.1 1233 CDS 100% 4.950 3.960 N Phldb1 n/a
6 TRCN0000295455 ATCCACCTTCCTGCGCTTTAA pLKO_005 523 CDS 100% 13.200 9.240 N Phldb1 n/a
7 TRCN0000295456 CAAGAAGACAAATTGTGTTAT pLKO_005 4463 3UTR 100% 13.200 9.240 N Phldb1 n/a
8 TRCN0000295404 CCGCTCCTCTAGCTACCATTT pLKO_005 1006 CDS 100% 10.800 7.560 N Phldb1 n/a
9 TRCN0000106001 GCAGGAAATCATGGATTCATT pLKO.1 736 CDS 100% 5.625 3.938 N Phldb1 n/a
10 TRCN0000106000 CCTCCCATTCTAACAGGACTA pLKO.1 5249 3UTR 100% 4.050 2.835 N Phldb1 n/a
11 TRCN0000152972 GAGACTGAGACAAAGCTCTTT pLKO.1 2684 CDS 100% 4.950 2.970 N PHLDB1 n/a
12 TRCN0000418641 AGCGCACCCTTTCCTATTATG pLKO_005 4032 CDS 100% 13.200 18.480 N PHLDB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030243973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488190 CTGAACTGGGGGTAGCATCTTATC pLX_317 8.9% 83.3% 89.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491363 CTGATCGGTTGCCGTGTGGTGCGG pLX_317 1.1% 76.4% 53.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_11690 pDONR223 100% 6.7% 7.2% None (many diffs) n/a
4 ccsbBroad304_11690 pLX_304 0% 6.7% 7.2% V5 (many diffs) n/a
5 TRCN0000473611 TCAATCCTGAGCTGCAGGCAATGA pLX_317 100% 6.7% 7.2% V5 (many diffs) n/a
Download CSV