Transcript: Human XR_001749455.2

PREDICTED: Homo sapiens tubulin gamma complex associated protein 3 (TUBGCP3), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TUBGCP3 (10426)
Length:
4103
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001749455.2
NBCI Gene record:
TUBGCP3 (10426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001749455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108336 CGGGTGGTACTATGGAAATTA pLKO.1 905 3UTR 100% 15.000 21.000 N TUBGCP3 n/a
2 TRCN0000108338 GCCACTACCTAAGAGTATTTA pLKO.1 2364 3UTR 100% 15.000 21.000 N TUBGCP3 n/a
3 TRCN0000431039 TTCCTGTACCGCTGGATATAT pLKO_005 1474 3UTR 100% 15.000 21.000 N TUBGCP3 n/a
4 TRCN0000108335 CGACATGGATAATGAAGATTT pLKO.1 3912 3UTR 100% 13.200 9.240 N TUBGCP3 n/a
5 TRCN0000091980 GAGGACACTTACCACGAATTT pLKO.1 1507 3UTR 100% 13.200 9.240 N Tubgcp3 n/a
6 TRCN0000108339 GCATGGACTTTAACTGCAAAT pLKO.1 799 3UTR 100% 10.800 7.560 N TUBGCP3 n/a
7 TRCN0000108337 CCTGAGAAACATGCCAGAGTT pLKO.1 2461 3UTR 100% 4.950 3.465 N TUBGCP3 n/a
8 TRCN0000429682 TGCACTGCTAGACACGAAATT pLKO_005 3155 3UTR 100% 13.200 6.600 Y TUBGCP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001749455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11497 pDONR223 100% 60.1% None (many diffs) n/a
2 ccsbBroad304_11497 pLX_304 0% 60.1% V5 (many diffs) n/a
3 TRCN0000479745 TACCAATGGACGCTCGAGTAGTCT pLX_317 14.4% 60.1% V5 (many diffs) n/a
4 ccsbBroadEn_11496 pDONR223 100% 30.7% None (many diffs) n/a
5 ccsbBroad304_11496 pLX_304 0% 30.7% V5 (many diffs) n/a
6 TRCN0000480095 ACAACAACATTCGCGCAAGGGGGT pLX_317 30.4% 30.7% V5 (many diffs) n/a
Download CSV