Transcript: Human XR_001753756.2

PREDICTED: Homo sapiens zinc finger protein 91 (ZNF91), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF91 (7644)
Length:
5024
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753756.2
NBCI Gene record:
ZNF91 (7644)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753756.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431137 TAGGAAATCTTCAACTCTTAC pLKO_005 3098 3UTR 100% 10.800 8.640 N ZNF91 n/a
2 TRCN0000435183 GCGTTTATATTACAGAGAAGT pLKO_005 778 3UTR 100% 4.950 3.960 N ZNF91 n/a
3 TRCN0000454945 AGACAATCCTTAACCCTTAAT pLKO_005 1755 3UTR 100% 13.200 9.240 N ZNF91 n/a
4 TRCN0000431335 CTCAAGTCTTTCTACACATAA pLKO_005 1931 3UTR 100% 13.200 9.240 N ZNF91 n/a
5 TRCN0000417830 CGTTCTTCAACCCTTGCTAAA pLKO_005 1170 3UTR 100% 10.800 7.560 N ZNF91 n/a
6 TRCN0000420667 GCCAGACCTGATTACTTATCT pLKO_005 347 3UTR 100% 5.625 3.938 N ZNF91 n/a
7 TRCN0000015437 CCATTCTTCAGCCCTTGCTAA pLKO.1 2093 3UTR 100% 4.950 3.465 N ZNF91 n/a
8 TRCN0000015435 GCCATTCTTCAACCCTTGCTA pLKO.1 1084 3UTR 100% 3.000 2.100 N ZNF91 n/a
9 TRCN0000015434 CCCAACATAAATGCGTTTATA pLKO.1 766 3UTR 100% 1.500 1.050 N ZNF91 n/a
10 TRCN0000425450 AGCGACTCTCAACCCTTACTA pLKO_005 1336 3UTR 100% 5.625 3.375 N ZNF91 n/a
11 TRCN0000015436 GCAAAGCATTTAGCCAGCCTT pLKO.1 2920 3UTR 100% 2.640 1.584 N ZNF91 n/a
12 TRCN0000427608 GTGCACAAAGAAGGTTATAAT pLKO_005 573 3UTR 100% 15.000 7.500 Y ZNF431 n/a
13 TRCN0000236730 CCCTTACTACACATAAGATAA pLKO_005 3028 3UTR 100% 13.200 6.600 Y ZNF98 n/a
14 TRCN0000225755 CCGGAGAGAAACCCTACAAAT pLKO_005 3475 3UTR 100% 13.200 6.600 Y Zfp808 n/a
15 TRCN0000428574 CTGAAGAGAAACCCTACAAAT pLKO_005 1291 3UTR 100% 13.200 6.600 Y ZNF138 n/a
16 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1039 3UTR 100% 13.200 6.600 Y Zfp934 n/a
17 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1039 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
18 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1039 3UTR 100% 13.200 6.600 Y EG668616 n/a
19 TRCN0000018187 CCCAGAGCAAAGTATTTCAAT pLKO.1 619 3UTR 100% 5.625 2.813 Y ZNF90 n/a
20 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1037 3UTR 100% 4.950 2.475 Y ZNF254 n/a
21 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 296 3UTR 100% 4.950 2.475 Y ZNF493 n/a
22 TRCN0000149073 GCAAAGCCTTTAACCAGTCTT pLKO.1 3592 3UTR 100% 4.950 2.475 Y ZNF714 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753756.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02188 pDONR223 100% 34.8% None (many diffs) n/a
2 ccsbBroad304_02188 pLX_304 0% 34.8% V5 (many diffs) n/a
3 TRCN0000476436 TCCGTGTTGGTCAAGCGACGCGCC pLX_317 12.5% 34.8% V5 (many diffs) n/a
4 ccsbBroadEn_11384 pDONR223 100% 5% None (many diffs) n/a
5 ccsbBroad304_11384 pLX_304 0% 5% V5 (many diffs) n/a
6 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 5% V5 (many diffs) n/a
7 ccsbBroadEn_15729 pDONR223 0% 4.3% None (many diffs) n/a
8 ccsbBroad304_15729 pLX_304 0% 4.3% V5 (many diffs) n/a
9 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 4.3% V5 (many diffs) n/a
10 ccsbBroadEn_13746 pDONR223 100% 4.2% None (many diffs) n/a
11 ccsbBroad304_13746 pLX_304 0% 4.2% V5 (many diffs) n/a
12 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 4.2% V5 (many diffs) n/a
Download CSV