Transcript: Human XR_002957634.1

PREDICTED: Homo sapiens golgin A8 family member G (GOLGA8G), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOLGA8G (283768)
Length:
1571
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957634.1
NBCI Gene record:
GOLGA8G (283768)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152236 CAGTTGAAGGAGTCACTTAAA pLKO.1 777 3UTR 100% 13.200 6.600 Y GOLGA8EP n/a
2 TRCN0000151329 GAGATGCCATCAGAAAGTTTA pLKO.1 1467 3UTR 100% 13.200 6.600 Y GOLGA8F n/a
3 TRCN0000269218 CAGTTGGAGCAGCAAGTAAAG pLKO_005 1257 3UTR 100% 10.800 5.400 Y GOLGA6L9 n/a
4 TRCN0000153701 CAAGGAGCTGAACAATGAGAA pLKO.1 1223 3UTR 100% 4.950 2.475 Y GOLGA8G n/a
5 TRCN0000158108 CAGAGAGAGATGCCATCAGAA pLKO.1 1461 3UTR 100% 4.950 2.475 Y GOLGA8G n/a
6 TRCN0000157310 CAGCGCATAAGTCTCCTGAAT pLKO.1 1089 3UTR 100% 4.950 2.475 Y GOLGA8G n/a
7 TRCN0000158334 CTACAGTTGGAGCAGCAAGTA pLKO.1 1254 3UTR 100% 4.950 2.475 Y GOLGA8G n/a
8 TRCN0000157512 GCTCGTTGAAGAAGGAGAAGA pLKO.1 892 3UTR 100% 4.950 2.475 Y GOLGA8F n/a
9 TRCN0000157882 CTCAAACACCAGATGGCTGAA pLKO.1 960 3UTR 100% 4.050 2.025 Y GOLGA8G n/a
10 TRCN0000152781 GAGAGGGATGAATATGCTGAA pLKO.1 810 3UTR 100% 4.050 2.025 Y GOLGA8G n/a
11 TRCN0000153085 GCAACATTCATTGCAGCGTAA pLKO.1 608 3UTR 100% 4.050 2.025 Y GOLGA8IP n/a
12 TRCN0000150773 GCATGATAAATATCGGGTAGA pLKO.1 914 3UTR 100% 4.050 2.025 Y GOLGA8G n/a
13 TRCN0000152577 GTCCAAACTCAAACACCAGAT pLKO.1 953 3UTR 100% 4.050 2.025 Y GOLGA8G n/a
14 TRCN0000154849 GAACAGCTTCAAGGAGCTGAA pLKO.1 1214 3UTR 100% 0.405 0.203 Y GOLGA8EP n/a
15 TRCN0000152586 GACACAGTTGAAGGAGTCATT pLKO.1 773 3UTR 100% 4.950 2.475 Y GOLGA8IP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07828 pDONR223 100% 64% None (many diffs) n/a
2 ccsbBroad304_07828 pLX_304 0% 64% V5 (many diffs) n/a
3 TRCN0000477056 CCAAAGGCACCTCCGCCCTGATCT pLX_317 21.8% 64% V5 (many diffs) n/a
4 ccsbBroadEn_10341 pDONR223 100% 42.6% None 1_716del;1376_1377ins92;1571_1572ins343 n/a
5 ccsbBroad304_10341 pLX_304 0% 42.6% V5 1_716del;1376_1377ins92;1571_1572ins343 n/a
6 TRCN0000476380 AGTGATAACGTTCAAGGTCGCGGA pLX_317 28.7% 42.6% V5 1_716del;1376_1377ins92;1571_1572ins343 n/a
7 ccsbBroadEn_16170 pDONR223 0% 42.4% None (many diffs) n/a
8 ccsbBroad304_16170 pLX_304 0% 42.4% V5 (many diffs) n/a
9 ccsbBroadEn_16172 pDONR223 0% 26.4% None 1_716del;1076_1424del;1571_1572ins343 n/a
10 ccsbBroad304_16172 pLX_304 0% 26.4% V5 1_716del;1076_1424del;1571_1572ins343 n/a
11 TRCN0000480289 TACTAACTTATTTTTTGACAAACC pLX_317 100% 12.2% V5 (not translated due to prior stop codon) 1_716del;910_1571del n/a
Download CSV