Transcript: Human XR_002958321.1

PREDICTED: Homo sapiens zinc finger protein 44 (ZNF44), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF44 (51710)
Length:
9531
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958321.1
NBCI Gene record:
ZNF44 (51710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958321.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364643 CTTAAGCCAGATTCGAAATAG pLKO_005 593 3UTR 100% 13.200 18.480 N ZNF44 n/a
2 TRCN0000369363 ATCTTATGAGTGTCAAATTTG pLKO_005 1850 3UTR 100% 13.200 9.240 N ZNF44 n/a
3 TRCN0000364642 CACCGGGAGTGTCATGAATAT pLKO_005 732 3UTR 100% 13.200 9.240 N ZNF44 n/a
4 TRCN0000017006 CAGTGTGAATGGAGAAGTCAT pLKO.1 659 3UTR 100% 4.950 3.465 N ZNF44 n/a
5 TRCN0000017004 CCCTCTTTCCTTCTAAGACAT pLKO.1 1974 3UTR 100% 4.950 3.465 N ZNF44 n/a
6 TRCN0000017003 GCCCTCATAAATGCACAGTAT pLKO.1 1516 3UTR 100% 4.950 3.465 N ZNF44 n/a
7 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 3607 3UTR 100% 15.000 7.500 Y Gm10771 n/a
8 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 3607 3UTR 100% 15.000 7.500 Y ZNF286B n/a
9 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1171 3UTR 100% 13.200 6.600 Y Zfp934 n/a
10 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1171 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
11 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1171 3UTR 100% 13.200 6.600 Y EG668616 n/a
12 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 3440 3UTR 100% 5.625 2.813 Y ZNF345 n/a
13 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1169 3UTR 100% 4.950 2.475 Y ZNF254 n/a
14 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1254 3UTR 100% 15.000 7.500 Y ZNF443 n/a
15 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1254 3UTR 100% 15.000 7.500 Y Zfp97 n/a
16 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1592 3UTR 100% 13.200 6.600 Y Zfp977 n/a
17 TRCN0000107953 GCTGTGAACTTCACCCAGGAA pLKO.1 2137 3UTR 100% 2.640 1.320 Y ZNF799 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958321.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05002 pDONR223 100% 12.7% None (many diffs) n/a
2 ccsbBroad304_05002 pLX_304 0% 12.7% V5 (many diffs) n/a
3 TRCN0000481100 ACGCTTAGGCTAATGTCCTTGTGC pLX_317 27.2% 12.7% V5 (many diffs) n/a
4 ccsbBroadEn_12010 pDONR223 100% 4.3% None (many diffs) n/a
5 ccsbBroad304_12010 pLX_304 0% 4.3% V5 (many diffs) n/a
6 TRCN0000470907 AAAGACTCTGTCACTTAAGCGGAC pLX_317 74.6% 4.3% V5 (many diffs) n/a
7 ccsbBroadEn_12011 pDONR223 100% 2.3% None (many diffs) n/a
8 ccsbBroad304_12011 pLX_304 0% 2.3% V5 (many diffs) n/a
9 TRCN0000475224 GACGTGGTCCTGCTCACGCGACGA pLX_317 100% 2.3% V5 (many diffs) n/a
Download CSV