Transcript: Human XR_002959124.1

PREDICTED: Homo sapiens cTAGE family member 4-like (LOC112268382), misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC112268382 (112268382)
Length:
2615
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959124.1
NBCI Gene record:
LOC112268382 (112268382)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337222 AGAGCTTACAGAGCATATTAA pLKO_005 1088 3UTR 100% 15.000 7.500 Y CTAGE9 n/a
2 TRCN0000337161 ATGAATTGATGGCGGATATTT pLKO_005 529 3UTR 100% 15.000 7.500 Y CTAGE9 n/a
3 TRCN0000337162 CAACGCTTTCTGGACTAATTG pLKO_005 277 3UTR 100% 13.200 6.600 Y CTAGE9 n/a
4 TRCN0000159554 CCAAAGATGATCTTGGTAATT pLKO.1 2041 3UTR 100% 13.200 6.600 Y MIA2 n/a
5 TRCN0000158819 GAAAGAAACCTCAGTGATTTA pLKO.1 1455 3UTR 100% 13.200 6.600 Y CTAGE4 n/a
6 TRCN0000161026 GAAGAGCTTACAGAGCATATT pLKO.1 1086 3UTR 100% 13.200 6.600 Y CTAGE4 n/a
7 TRCN0000147704 GATGAATTGATGGCGGATATT pLKO.1 528 3UTR 100% 13.200 6.600 Y CTAGE6 n/a
8 TRCN0000159081 GATGATGATAACCTGGAATTA pLKO.1 903 3UTR 100% 13.200 6.600 Y CTAGE4 n/a
9 TRCN0000161255 GCCAAAGATGATCTTGGTAAT pLKO.1 2040 3UTR 100% 10.800 5.400 Y CTAGE4 n/a
10 TRCN0000160201 CCAAAGATCTTGAAGAAGAAT pLKO.1 1348 3UTR 100% 5.625 2.813 Y CTAGE4 n/a
11 TRCN0000160970 GACCATCAGATTACCAATGAA pLKO.1 1743 3UTR 100% 5.625 2.813 Y CTAGE4 n/a
12 TRCN0000158680 GCTTTGAAGAAACTGATTCAT pLKO.1 978 3UTR 100% 5.625 2.813 Y MIA2 n/a
13 TRCN0000146679 CAATGCCTTCAGAAATGGAAT pLKO.1 2005 3UTR 100% 4.950 2.475 Y CTAGE6 n/a
14 TRCN0000162203 CAGGTTATTTCCTACGAGAAA pLKO.1 1398 3UTR 100% 4.950 2.475 Y CTAGE4 n/a
15 TRCN0000166046 CCACAGCAAGAAACCTGACAA pLKO.1 2440 3UTR 100% 4.950 2.475 Y CTAGE4 n/a
16 TRCN0000159985 CGATGTTTCAAATACAGCATT pLKO.1 1559 3UTR 100% 4.950 2.475 Y CTAGE4 n/a
17 TRCN0000162293 CTGAAAGAAACCTCAGTGATT pLKO.1 1453 3UTR 100% 4.950 2.475 Y CTAGE15 n/a
18 TRCN0000158755 GAAATGAAACTCTACAGGAAA pLKO.1 1221 3UTR 100% 4.950 2.475 Y CTAGE4 n/a
19 TRCN0000161860 GCCAAAGATCTTGAAGAAGAA pLKO.1 1347 3UTR 100% 4.950 2.475 Y CTAGE4 n/a
20 TRCN0000005402 GCTATGAAGTAGAGTCATCTT pLKO.1 352 3UTR 100% 4.950 2.475 Y CTAGE1 n/a
21 TRCN0000163166 GCTGAAAGAAACCTCAGTGAT pLKO.1 1452 3UTR 100% 4.950 2.475 Y CTAGE15 n/a
22 TRCN0000166516 CCAGGGCAATCATATCCTGAT pLKO.1 1872 3UTR 100% 4.050 2.025 Y CTAGE4 n/a
23 TRCN0000149765 GCAGGTTATTTCCTACGAGAA pLKO.1 1397 3UTR 100% 4.050 2.025 Y CTAGE6 n/a
24 TRCN0000163445 GCAGGTTATTTCCTACGAGAA pLKO.1 1397 3UTR 100% 4.050 2.025 Y CTAGE15 n/a
25 TRCN0000163117 GCTGAAGTATGGAAAGGACAA pLKO.1 729 3UTR 100% 4.050 2.025 Y CTAGE15 n/a
26 TRCN0000148639 CCAATGAAAGAGGAGAACCAA pLKO.1 1756 3UTR 100% 3.000 1.500 Y CTAGE6 n/a
27 TRCN0000162809 CCAATGAAAGAGGAGAACCAA pLKO.1 1756 3UTR 100% 3.000 1.500 Y CTAGE15 n/a
28 TRCN0000146457 CCTCAAACTTTGTTGGAGGAT pLKO.1 1653 3UTR 100% 2.640 1.320 Y CTAGE6 n/a
29 TRCN0000164371 CAAGATGAATTGATGGCGGAT pLKO.1 525 3UTR 100% 2.160 1.080 Y CTAGE15 n/a
30 TRCN0000147443 GCAGAACAAGTTCTGAATGAT pLKO.1 801 3UTR 100% 0.563 0.281 Y CTAGE6 n/a
31 TRCN0000160834 GCAGAACAAGTTCTGAATGAT pLKO.1 801 3UTR 100% 0.563 0.281 Y CTAGE15 n/a
32 TRCN0000174282 CAGTTTAAGTAACTGCTGTTA pLKO.1 2504 3UTR 100% 0.495 0.248 Y n/a
33 TRCN0000337160 TCGGTTAGGAGTCGGCTTTAT pLKO_005 231 3UTR 100% 13.200 6.600 Y CTAGE9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10967 pDONR223 100% 84.1% None (many diffs) n/a
2 ccsbBroad304_10967 pLX_304 0% 84.1% V5 (many diffs) n/a
3 TRCN0000470328 CTTGCATGAATTTATTTTATTCTT pLX_317 13.8% 84.1% V5 (many diffs) n/a
4 ccsbBroadEn_13076 pDONR223 100% 83.7% None (many diffs) n/a
5 ccsbBroad304_13076 pLX_304 0% 83.7% V5 (many diffs) n/a
6 TRCN0000481377 AACTAGAGAATGGGATCGGTCGAA pLX_317 19.7% 83.7% V5 (many diffs) n/a
7 ccsbBroadEn_13596 pDONR223 100% 82.3% None (many diffs) n/a
8 ccsbBroad304_13596 pLX_304 0% 82.3% V5 (many diffs) n/a
9 ccsbBroadEn_03960 pDONR223 100% 76.4% None (many diffs) n/a
10 ccsbBroad304_03960 pLX_304 0% 76.4% V5 (many diffs) n/a
11 TRCN0000469836 CGAATATCTAATGCTCGTTTGACG pLX_317 17.1% 76.4% V5 (many diffs) n/a
12 ccsbBroadEn_10968 pDONR223 100% 76.2% None (many diffs) n/a
13 ccsbBroad304_10968 pLX_304 0% 76.2% V5 (many diffs) n/a
14 TRCN0000475416 ATAGTTAGCGCAGAAAAGATACGG pLX_317 11.5% 76.2% V5 (many diffs) n/a
Download CSV