Transcript: Human XR_929803.1

PREDICTED: Homo sapiens COBW domain containing 3 (CBWD3), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CBWD3 (445571)
Length:
1164
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_929803.1
NBCI Gene record:
CBWD3 (445571)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_929803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242508 ACAACACTTCTGAACTATATT pLKO_005 332 3UTR 100% 15.000 7.500 Y CBWD1 n/a
2 TRCN0000242509 ACAATTATCACCGGGTATTTA pLKO_005 299 3UTR 100% 15.000 7.500 Y CBWD1 n/a
3 TRCN0000426044 CAACACTTCTGAACTATATTT pLKO_005 333 3UTR 100% 15.000 7.500 Y CBWD2 n/a
4 TRCN0000242510 CTGAATTAGGGAGTGATATTT pLKO_005 627 3UTR 100% 15.000 7.500 Y CBWD1 n/a
5 TRCN0000262469 CACAATTATCACCGGGTATTT pLKO_005 298 3UTR 100% 13.200 6.600 Y CBWD6 n/a
6 TRCN0000130195 CCAAGATCCCAGTCACAATTA pLKO.1 285 3UTR 100% 13.200 6.600 Y CBWD2 n/a
7 TRCN0000242511 CTTGATGGTATCATAACTATT pLKO_005 650 3UTR 100% 13.200 6.600 Y CBWD1 n/a
8 TRCN0000262471 TTGATGGTATCATAACTATTG pLKO_005 651 3UTR 100% 10.800 5.400 Y CBWD6 n/a
9 TRCN0000135519 GATGCTGAATTAGGGAGTGAT pLKO.1 623 3UTR 100% 4.950 2.475 Y CBWD3 n/a
10 TRCN0000134746 GCCTTATCAATGAAGCTACTA pLKO.1 720 3UTR 100% 4.950 2.475 Y CBWD3 n/a
11 TRCN0000135615 GTCACAATTATCACCGGGTAT pLKO.1 296 3UTR 100% 4.050 2.025 Y CBWD3 n/a
12 TRCN0000128085 CTCTATGAAGAGTGGCTGGAA pLKO.1 452 3UTR 100% 2.640 1.320 Y CBWD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_929803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15265 pDONR223 73.3% 49.8% None (many diffs) n/a
2 ccsbBroad304_15265 pLX_304 0% 49.8% V5 (many diffs) n/a
3 ccsbBroadEn_10172 pDONR223 100% 50.6% None (many diffs) n/a
4 ccsbBroad304_10172 pLX_304 0% 50.6% V5 (many diffs) n/a
5 ccsbBroadEn_08604 pDONR223 100% 50.2% None (many diffs) n/a
6 ccsbBroad304_08604 pLX_304 0% 50.2% V5 (many diffs) n/a
7 ccsbBroadEn_03674 pDONR223 100% 50.1% None (many diffs) n/a
8 ccsbBroad304_03674 pLX_304 0% 50.1% V5 (many diffs) n/a
9 TRCN0000492257 CAGAGTAATCATATCCCTTTGTTC pLX_317 36.1% 50.1% V5 (many diffs) n/a
10 ccsbBroadEn_09670 pDONR223 100% 49.8% None (many diffs) n/a
11 TRCN0000473698 TTACTTGTTCAATCGAACGCGGTT pLX_317 42.3% 49.8% V5 (many diffs) n/a
12 ccsbBroadEn_13415 pDONR223 100% 46% None (many diffs) n/a
13 ccsbBroad304_13415 pLX_304 0% 46% V5 (many diffs) n/a
14 TRCN0000480607 CTTTTTTTTCAGTAGCCCCGCCGA pLX_317 73.5% 46% V5 (many diffs) n/a
15 ccsbBroadEn_08603 pDONR223 100% 42.1% None (many diffs) n/a
16 ccsbBroad304_08603 pLX_304 0% 42.1% V5 (many diffs) n/a
17 TRCN0000491579 GTTCACCCGAGATAGGATGAAGAC pLX_317 32.7% 42.1% V5 (many diffs) n/a
Download CSV