Transcript: Human XR_947813.2

PREDICTED: Homo sapiens pleckstrin homology like domain family B member 1 (PHLDB1), transcript variant X17, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHLDB1 (23187)
Length:
6591
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_947813.2
NBCI Gene record:
PHLDB1 (23187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_947813.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427103 AGACCACATCGACCCTCAAAG pLKO_005 3742 3UTR 100% 10.800 15.120 N PHLDB1 n/a
2 TRCN0000435050 AGCTGAAGGGAGTCATCTATT pLKO_005 5175 3UTR 100% 13.200 9.240 N PHLDB1 n/a
3 TRCN0000418636 AGAACTTGCAGTAACCCTTTA pLKO_005 5547 3UTR 100% 10.800 7.560 N PHLDB1 n/a
4 TRCN0000418350 CCTCTCATGCACCACTCTATC pLKO_005 4641 3UTR 100% 10.800 7.560 N PHLDB1 n/a
5 TRCN0000428621 CCTGAACCTGTGTGCCGAATA pLKO_005 2750 3UTR 100% 10.800 7.560 N PHLDB1 n/a
6 TRCN0000156825 GCTGAAGCCAAGTGGATGAAA pLKO.1 1305 3UTR 100% 5.625 3.938 N PHLDB1 n/a
7 TRCN0000426499 CAAGGGCCAGAGATCTCAAGT pLKO_005 5857 3UTR 100% 4.950 3.465 N PHLDB1 n/a
8 TRCN0000153543 CGTATCTGGATGGATGTCATT pLKO.1 5327 3UTR 100% 4.950 3.465 N PHLDB1 n/a
9 TRCN0000152972 GAGACTGAGACAAAGCTCTTT pLKO.1 3423 3UTR 100% 4.950 3.465 N PHLDB1 n/a
10 TRCN0000153924 CCATTGTTCTCCTTTCCCTTA pLKO.1 5817 3UTR 100% 4.050 2.835 N PHLDB1 n/a
11 TRCN0000157566 GCTGAAAGTGCAAACGGACAA pLKO.1 995 3UTR 100% 4.050 2.835 N PHLDB1 n/a
12 TRCN0000158369 CTCATGCACCACTCTATCCTA pLKO.1 4644 3UTR 100% 3.000 2.100 N PHLDB1 n/a
13 TRCN0000153124 GCAGAATCAGAAAGTCTGGTA pLKO.1 1380 3UTR 100% 2.640 1.848 N PHLDB1 n/a
14 TRCN0000428665 AGCTTGGTCCTGTGAGTTTCT pLKO_005 5455 3UTR 100% 4.950 2.970 N PHLDB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_947813.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488190 CTGAACTGGGGGTAGCATCTTATC pLX_317 8.9% 57.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491363 CTGATCGGTTGCCGTGTGGTGCGG pLX_317 1.1% 55% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_11690 pDONR223 100% 4% None (many diffs) n/a
4 ccsbBroad304_11690 pLX_304 0% 4% V5 (many diffs) n/a
5 TRCN0000473611 TCAATCCTGAGCTGCAGGCAATGA pLX_317 100% 4% V5 (many diffs) n/a
Download CSV