Construct: ORF TRCN0000466799
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018427.1_s317c1
- Derived from:
- ccsbBroadEn_07015
- DNA Barcode:
- CATACAATGTCGAAGTCAAGGAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SULT1A1 (6817)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466799
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | NM_001055.3 | 99.8% | 99.6% | 638G>A |
2 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | NM_177529.2 | 99.8% | 99.6% | 638G>A |
3 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | NM_177530.2 | 99.8% | 99.6% | 638G>A |
4 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | NM_177534.2 | 99.8% | 99.6% | 638G>A |
5 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_017023611.2 | 99.8% | 99.6% | 638G>A |
6 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_017023612.2 | 99.8% | 99.6% | 638G>A |
7 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_017023613.2 | 99.8% | 99.6% | 638G>A |
8 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_024450409.1 | 99.8% | 99.6% | 638G>A |
9 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_024450410.1 | 99.8% | 99.6% | 638G>A |
10 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_024450411.1 | 99.8% | 99.6% | 638G>A |
11 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_017023604.1 | 97.8% | 97.6% | 593_610del;656G>A |
12 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_017023605.1 | 97.8% | 97.6% | 593_610del;656G>A |
13 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_017023608.1 | 97.8% | 97.6% | 593_610del;656G>A |
14 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_017023609.1 | 97.8% | 97.6% | 593_610del;656G>A |
15 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_017023610.1 | 97.8% | 97.6% | 593_610del;656G>A |
16 | human | 6799 | SULT1A2 | sulfotransferase family 1A ... | NM_177528.2 | 96.8% | 95.5% | (many diffs) |
17 | human | 6799 | SULT1A2 | sulfotransferase family 1A ... | NM_001054.4 | 96.7% | 95.2% | (many diffs) |
18 | human | 445329 | SULT1A4 | sulfotransferase family 1A ... | NM_001017390.2 | 94.3% | 92.5% | (many diffs) |
19 | human | 6818 | SULT1A3 | sulfotransferase family 1A ... | NM_177552.3 | 94.3% | 92.5% | (many diffs) |
20 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_017023607.2 | 76.3% | 76.1% | 1_273del;911G>A |
21 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XM_024450408.1 | 76.1% | 75.9% | 1_276del;914G>A |
22 | human | 6799 | SULT1A2 | sulfotransferase family 1A ... | NM_001363863.1 | 69.7% | 64.7% | (many diffs) |
23 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | NM_177536.3 | 65.9% | 59% | (many diffs) |
24 | human | 6817 | SULT1A1 | sulfotransferase family 1A ... | XR_001751973.1 | 65% | (many diffs) | |
25 | human | 100526831 | SLX1B-SULT1A4 | SLX1B-SULT1A4 readthrough (... | NR_037609.1 | 37.7% | (many diffs) | |
26 | human | 100526830 | SLX1A-SULT1A3 | SLX1A-SULT1A3 readthrough (... | NR_037608.1 | 37.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 951
- ORF length:
- 885
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gctgatccag gacacctccc gcccgccact ggagtacgtg aagggggtcc 121 cgctcatcaa gtactttgca gaggcactgg ggcccctgca gagcttccag gcccggcctg 181 atgacctgct catcagcacc taccccaagt ccggcactac ctgggtaagc cagattctgg 241 acatgatcta ccagggtggt gacctggaga agtgtcaccg agctcccatc ttcatgcggg 301 tgcccttcct tgagttcaaa gccccaggga ttccctcagg gatggagact ctgaaagaca 361 caccggcccc acgactcctg aagacacacc tgcccctggc tctgctcccc cagactctgt 421 tggatcagaa ggtcaaggtg gtctatgttg cccgcaacgc aaaggatgtg gcagtttcct 481 actaccactt ctaccacatg gccaaggtgc accctgagcc tgggacctgg gacagcttcc 541 tggagaagtt catggtcgga gaagtgtcct acggatcctg gtaccagcac gtgcaggagt 601 ggtgggagct gagccgcacc caccctgttc tctaccTCTT CTATGAAGAC ATGAAGGAGA 661 ACCCGAAAAG GGAGATTCAA AAGATCCTGG AGTTTGTGGG GCACTCCCTG CCAGAGGAGA 721 CCGTGGACTT CGTGGTTCAG CACACGTCGT TCAAGGAGAT GAAGAAGAAC CCTATGACCA 781 ACTACACCAC CGTCCCCCAG GAGTTCATGG ACCACAGCAT CTCCCCCTTC ATGAGGAAAG 841 GCATGGCTGG GGACTGGAAG ACCACCTTCA CCGTGGCGCA GAATGAGCGC TTCGATGCGG 901 ACTATGCGGA GAAGATGGCA GGCTGCAGCC TCAGCTTCCG CTCTGAGCTG TGCCCAACTT 961 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1021 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1081 CTTGTGGAAA GGACGACATA CAATGTCGAA GTCAAGGAAT ACGCGTTAAG TCgacaatca 1141 acctctggat tacaaaattt gtgaaagatt