Transcript: Human XM_017023605.1

PREDICTED: Homo sapiens sulfotransferase family 1A member 1 (SULT1A1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SULT1A1 (6817)
Length:
1335
CDS:
201..1106

Additional Resources:

NCBI RefSeq record:
XM_017023605.1
NBCI Gene record:
SULT1A1 (6817)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432180 ACCAAGCGGCTCAAGAATAAA pLKO_005 1154 3UTR 100% 15.000 10.500 N SULT1A1 n/a
2 TRCN0000035234 GAGAAGTTCATGGTCGGAGAA pLKO.1 678 CDS 100% 4.050 2.835 N SULT1A1 n/a
3 TRCN0000035236 ACGCAAAGGATGTGGCAGTTT pLKO.1 592 CDS 100% 4.950 2.970 N SULT1A1 n/a
4 TRCN0000035238 AGTTTCCTACTACCACTTCTA pLKO.1 608 CDS 100% 4.950 2.970 N SULT1A1 n/a
5 TRCN0000415811 GCTGAGGTGGGAGGATCATTT pLKO_005 1231 3UTR 100% 13.200 6.600 Y SULT1A1 n/a
6 TRCN0000254869 AGAAGGTCAAGGTGGTCTATG pLKO_005 562 CDS 100% 10.800 5.400 Y SULT1A4 n/a
7 TRCN0000434454 AGACCAACCTGGGCAACATAG pLKO_005 1267 3UTR 100% 10.800 5.400 Y SULT1A1 n/a
8 TRCN0000254871 TCCCGCTCATCAAGTACTTTG pLKO_005 253 CDS 100% 10.800 5.400 Y SULT1A4 n/a
9 TRCN0000419471 TGCCCTTCCTTGAGTTCAAAG pLKO_005 436 CDS 100% 10.800 5.400 Y SULT1A1 n/a
10 TRCN0000035202 CCTGTTCTCTACCTCTTCTAT pLKO.1 759 CDS 100% 5.625 2.813 Y SULT1A2 n/a
11 TRCN0000035201 GTCCCGCTCATCAAGTACTTT pLKO.1 252 CDS 100% 5.625 2.813 Y SULT1A2 n/a
12 TRCN0000035200 CAGAAGGTCAAGGTGGTCTAT pLKO.1 561 CDS 100% 4.950 2.475 Y SULT1A2 n/a
13 TRCN0000181155 CAGAAGGTCAAGGTGGTCTAT pLKO.1 561 CDS 100% 4.950 2.475 Y SULT1A4 n/a
14 TRCN0000431947 CAGATTCTGGACATGATCTAC pLKO_005 366 CDS 100% 4.950 2.475 Y SULT1A2 n/a
15 TRCN0000035313 CCTCTTCTATGAAGACATGAA pLKO.1 770 CDS 100% 4.950 2.475 Y SULT1A3 n/a
16 TRCN0000432229 GGTTCAGCACACGTCGTTCAA pLKO_005 887 CDS 100% 4.950 2.475 Y SULT1A3 n/a
17 TRCN0000416831 AGCGCTTCGATGCGGACTATG pLKO_005 1039 CDS 100% 3.600 1.800 Y SULT1A2 n/a
18 TRCN0000035203 AGGAGATGAAGAAGAACCCTA pLKO.1 907 CDS 100% 2.640 1.320 Y SULT1A2 n/a
19 TRCN0000035237 GATTCTGGACATGATCTACCA pLKO.1 368 CDS 100% 2.640 1.320 Y SULT1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07015 pDONR223 100% 97.8% 97.6% None 593_610del;656G>A n/a
2 ccsbBroad304_07015 pLX_304 0% 97.8% 97.6% V5 593_610del;656G>A n/a
3 TRCN0000466799 CATACAATGTCGAAGTCAAGGAAT pLX_317 35.9% 97.8% 97.6% V5 593_610del;656G>A n/a
4 ccsbBroadEn_01615 pDONR223 100% 95% 94% None (many diffs) n/a
5 ccsbBroad304_01615 pLX_304 0% 95% 94% V5 (many diffs) n/a
6 ccsbBroadEn_01621 pDONR223 100% 92.5% 91% None (many diffs) n/a
7 ccsbBroad304_01621 pLX_304 0% 92.5% 91% V5 (many diffs) n/a
8 TRCN0000467038 ATGCTACGCCCGAGCGTATCCGTA pLX_317 35.5% 92.5% 91% V5 (many diffs) n/a
9 ccsbBroadEn_07016 pDONR223 100% 92.3% 90.6% None (many diffs) n/a
10 ccsbBroad304_07016 pLX_304 0% 92.3% 90.6% V5 (many diffs) n/a
11 TRCN0000466576 ATCCCCCCGAGGACTACGCACATA pLX_317 30.4% 92.3% 90.6% V5 (many diffs) n/a
Download CSV