Transcript: Mouse NM_001003672.1

Mus musculus protocadherin alpha subfamily C, 2 (Pcdhac2), mRNA.

Source:
NCBI, updated 2017-04-25
Taxon:
Mus musculus (mouse)
Gene:
Pcdhac2 (353237)
Length:
5422
CDS:
1..3021

Additional Resources:

NCBI RefSeq record:
NM_001003672.1
NBCI Gene record:
Pcdhac2 (353237)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001003672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094940 CCAAAGTCATAGCCATGGATT pLKO.1 1811 CDS 100% 4.950 3.465 N Pcdhac2 n/a
2 TRCN0000094942 CCTCAAAGTACAGCCTCACTT pLKO.1 2310 CDS 100% 4.950 3.465 N Pcdhac2 n/a
3 TRCN0000094941 CCGGATTATCAGCTTCAGGTA pLKO.1 448 CDS 100% 2.640 1.848 N Pcdhac2 n/a
4 TRCN0000055532 GCTGTCAACTCCTTTGACTAT pLKO.1 1594 CDS 100% 0.495 0.347 N PCDHAC2 n/a
5 TRCN0000094943 CAGCCTCACTTCATTGAGGTT pLKO.1 2320 CDS 100% 0.264 0.185 N Pcdhac2 n/a
6 TRCN0000094087 CGGTGAGTTGCCAGACAAATT pLKO.1 2811 CDS 100% 13.200 6.600 Y Pcdha6 n/a
7 TRCN0000094979 GCATCCTGTCTTGATGATATT pLKO.1 3340 3UTR 100% 13.200 6.600 Y Pcdha9 n/a
8 TRCN0000094984 GCCAGCAGTTCAAGCGTTTAA pLKO.1 3709 3UTR 100% 13.200 6.600 Y Pcdha12 n/a
9 TRCN0000094754 GCTGCTACAGAAGTGCTTTAA pLKO.1 4038 3UTR 100% 13.200 6.600 Y Pcdha5 n/a
10 TRCN0000094349 CCTCACTTTATGCTGTTTGTT pLKO.1 3887 3UTR 100% 5.625 2.813 Y Pcdha4 n/a
11 TRCN0000094939 CGGAATATCAGCTTGTAGAAA pLKO.1 4872 3UTR 100% 5.625 2.813 Y Pcdhac2 n/a
12 TRCN0000094869 GCACAACTTAGATGTTTGATT pLKO.1 4941 3UTR 100% 5.625 2.813 Y Pcdhac1 n/a
13 TRCN0000094548 GCCTGCTAACAACCAAATTGA pLKO.1 2874 CDS 100% 5.625 2.813 Y Pcdha7 n/a
14 TRCN0000094089 CCGGAATATCAGCTTGTAGAA pLKO.1 4871 3UTR 100% 4.950 2.475 Y Pcdha1 n/a
15 TRCN0000094544 CGCTCCTTTCTCCTATGACAT pLKO.1 3095 3UTR 100% 4.950 2.475 Y Pcdha7 n/a
16 TRCN0000094699 GCCCTCAGAAATCTGCAGAAA pLKO.1 3118 3UTR 100% 4.950 2.475 Y Pcdha2 n/a
17 TRCN0000094086 GCTAACAACCAAATTGACAAA pLKO.1 2878 CDS 100% 4.950 2.475 Y Pcdha6 n/a
18 TRCN0000094179 GCTGGCTATAACATCACTGTA pLKO.1 3663 3UTR 100% 4.950 2.475 Y Pcdha10 n/a
19 TRCN0000094874 CCAAATGGAAACAAGCCACTT pLKO.1 3027 3UTR 100% 4.050 2.025 Y Pcdha8 n/a
20 TRCN0000094644 CCACCTTGTTTAGCTTTCCTT pLKO.1 4341 3UTR 100% 3.000 1.500 Y Pcdha11 n/a
21 TRCN0000094614 GCACTTTGATTACACAACCTT pLKO.1 4200 3UTR 100% 3.000 1.500 Y Pcdha3 n/a
22 TRCN0000094877 ACAAATTCATTATCCCAGGAT pLKO.1 2825 CDS 100% 2.640 1.320 Y Pcdha8 n/a
23 TRCN0000094183 CCCGGTGAGTTGCCAGACAAA pLKO.1 2809 CDS 100% 1.650 0.825 Y Pcdha10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08627 pDONR223 100% 75.8% 77.7% None (many diffs) n/a
2 ccsbBroad304_08627 pLX_304 0% 75.8% 77.7% V5 (many diffs) n/a
3 TRCN0000476553 ATCTAGCACTGAAGTGGAGTCCTG pLX_317 12.1% 75.8% 77.7% V5 (many diffs) n/a
Download CSV