Transcript: Mouse NM_001033124.1

Mus musculus neurotrophic tyrosine kinase, receptor, type 1 (Ntrk1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ntrk1 (18211)
Length:
2606
CDS:
19..2418

Additional Resources:

NCBI RefSeq record:
NM_001033124.1
NBCI Gene record:
Ntrk1 (18211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360697 TTGGAGTCTGCGCTGACTAAT pLKO_005 1021 CDS 100% 13.200 18.480 N Ntrk1 n/a
2 TRCN0000023314 GCATGTCAACAACGGGAACTA pLKO.1 1083 CDS 100% 4.950 6.930 N Ntrk1 n/a
3 TRCN0000360698 ATCTATAGCACAGACTATTAC pLKO_005 2050 CDS 100% 13.200 9.240 N Ntrk1 n/a
4 TRCN0000360696 GTGGCTGCTGGTATGGTATAT pLKO_005 1927 CDS 100% 13.200 9.240 N Ntrk1 n/a
5 TRCN0000360695 TCAAGCGCCAGGACATCATTC pLKO_005 1541 CDS 100% 10.800 7.560 N Ntrk1 n/a
6 TRCN0000023315 GCTCAACGAGACCAGTTTCAT pLKO.1 987 CDS 100% 5.625 3.938 N Ntrk1 n/a
7 TRCN0000023318 GCTGTATTAGCTCCAGAGGAT pLKO.1 1387 CDS 100% 2.640 1.848 N Ntrk1 n/a
8 TRCN0000023317 CTGGTCAATGTCACCAGTGAT pLKO.1 775 CDS 100% 0.495 0.347 N Ntrk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14720 pDONR223 0% 84.1% 85.7% None (many diffs) n/a
2 ccsbBroad304_14720 pLX_304 0% 84.1% 85.7% V5 (many diffs) n/a
3 TRCN0000469111 CGAATCGAACTGAGCTTCCAGCTA pLX_317 17.5% 84.1% 85.7% V5 (many diffs) n/a
4 TRCN0000488623 CGGACCAGCGCATGACCTTCAAGA pLX_317 11% 81.4% 82.9% V5 (many diffs) n/a
5 TRCN0000487892 ACCACTCCCTTCGGGGGACCGTGA pLX_317 10.2% 81.4% 82.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488699 TCGCATACTTCTTACGAACCCCTT pLX_317 33.4% 37.1% .3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV