Transcript: Mouse NM_001040106.2

Mus musculus AP2 associated kinase 1 (Aak1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Aak1 (269774)
Length:
19363
CDS:
537..3416

Additional Resources:

NCBI RefSeq record:
NM_001040106.2
NBCI Gene record:
Aak1 (269774)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001040106.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366925 ACCCTATTCCTGTACTAATTA pLKO_005 3286 CDS 100% 15.000 21.000 N Aak1 n/a
2 TRCN0000366970 TCACTACGAAGGCAGATATTT pLKO_005 1252 CDS 100% 15.000 21.000 N Aak1 n/a
3 TRCN0000366917 TGCACTGCCTTATTAGGTATA pLKO_005 1393 CDS 100% 10.800 15.120 N Aak1 n/a
4 TRCN0000001945 GCCACCAACAAATTCCAGAAT pLKO.1 1128 CDS 100% 4.950 3.960 N AAK1 n/a
5 TRCN0000376026 CTCTCTGCTCCCACTCATAAA pLKO_005 3189 CDS 100% 13.200 9.240 N Aak1 n/a
6 TRCN0000376027 ACGGATTCTCAGTGATGTAAC pLKO_005 2429 CDS 100% 10.800 7.560 N Aak1 n/a
7 TRCN0000088677 GAGCCAGTTCTTGCCAATCAA pLKO.1 12328 3UTR 100% 5.625 2.813 Y LOC545863 n/a
8 TRCN0000193090 CCTACAAGATTGTTTCACAAA pLKO.1 12933 3UTR 100% 4.950 2.475 Y Aak1 n/a
9 TRCN0000088673 CCTCGGTAATAGCTCTGCAAA pLKO.1 15690 3UTR 100% 4.950 2.475 Y LOC545863 n/a
10 TRCN0000088676 CGACACTATAGCCCAGAAGAT pLKO.1 12881 3UTR 100% 4.950 2.475 Y LOC545863 n/a
11 TRCN0000088674 GCCTACAAGATTGTTTCACAA pLKO.1 12932 3UTR 100% 4.950 2.475 Y LOC545863 n/a
12 TRCN0000176210 GCTGCCTACAAGATTGTTTCA pLKO.1 12929 3UTR 100% 4.950 2.475 Y Aak1 n/a
13 TRCN0000175498 CAAAGCAATAAGCAGCTGCTA pLKO.1 12950 3UTR 100% 2.640 1.320 Y Aak1 n/a
14 TRCN0000088675 GCAGTATCCTATGACTGGCTT pLKO.1 12664 3UTR 100% 2.640 1.320 Y LOC545863 n/a
15 TRCN0000174768 GCTTTATCCAAATATTCTCGA pLKO.1 12863 3UTR 100% 2.640 1.320 Y Aak1 n/a
16 TRCN0000178741 CACACACATACACACACACAA pLKO.1 18258 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040106.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489763 GGTGAGATCGGGAATAACTTGTGA pLX_317 12.5% 88.3% 90.8% V5 (many diffs) n/a
2 ccsbBroadEn_15743 pDONR223 0% 44.8% 46.5% None (many diffs) n/a
3 ccsbBroad304_15743 pLX_304 0% 44.8% 46.5% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_14996 pDONR223 0% 44.8% 46.5% None (many diffs) n/a
5 ccsbBroad304_14996 pLX_304 0% 44.8% 46.5% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000480400 TTCCGCAAACCAGCTCCAAAAACG pLX_317 27.7% 44.8% 46.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV