Transcript: Human NM_001099694.2

Homo sapiens zinc finger protein 578 (ZNF578), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ZNF578 (147660)
Length:
6768
CDS:
268..2040

Additional Resources:

NCBI RefSeq record:
NM_001099694.2
NBCI Gene record:
ZNF578 (147660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001099694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108190 CCCAGCCTGTTTATTATTATT pLKO.1 2899 3UTR 100% 15.000 10.500 N ZNF578 n/a
2 TRCN0000415703 AGTCACAGATCACGCCTTAAA pLKO_005 2093 3UTR 100% 13.200 9.240 N ZNF578 n/a
3 TRCN0000108192 TGAGTGTGGTAAGGCTCACAA pLKO.1 1977 CDS 100% 4.950 3.465 N ZNF578 n/a
4 TRCN0000108191 GCTCACAATCACTTGATTGAT pLKO.1 1990 CDS 100% 0.563 0.394 N ZNF578 n/a
5 TRCN0000108194 TGTGCCATTCTTATCTGGCAA pLKO.1 1913 CDS 100% 0.264 0.185 N ZNF578 n/a
6 TRCN0000424312 CCTGACATGCCATCGTAGATG pLKO_005 1170 CDS 100% 4.950 2.970 N ZNF578 n/a
7 TRCN0000108193 TGTAGCTCATTTGTAAGGAAA pLKO.1 991 CDS 100% 4.950 2.970 N ZNF578 n/a
8 TRCN0000018107 GCTGGAAACAAGCCTATTAAA pLKO.1 706 CDS 100% 15.000 7.500 Y ZNF600 n/a
9 TRCN0000146631 CCTCATTAGACATCAGAGAAT pLKO.1 2523 3UTR 100% 4.950 2.475 Y ZNF816 n/a
10 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4733 3UTR 100% 4.950 2.475 Y n/a
11 TRCN0000148019 GCAAAGCCTTTACTTCATGTT pLKO.1 2498 3UTR 100% 4.950 2.475 Y ZNF816 n/a
12 TRCN0000142662 GCAAGGCAATACAGAAGTGAT pLKO.1 501 CDS 100% 4.950 2.475 Y ZNF468 n/a
13 TRCN0000015885 GCAATTCATACTGGAGAGAAA pLKO.1 1438 CDS 100% 4.950 2.475 Y ZNF702P n/a
14 TRCN0000149463 GCACGTCATCATAGACTTCAT pLKO.1 1594 CDS 100% 4.950 2.475 Y ZNF321P n/a
15 TRCN0000142203 GCAGTGAGTATAGCAAACCAT pLKO.1 2654 3UTR 100% 3.000 1.500 Y ZNF468 n/a
16 TRCN0000142023 GTAAGGTTTGTGACAAGGCTT pLKO.1 1889 CDS 100% 2.640 1.320 Y ZNF468 n/a
17 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 2054 3UTR 100% 4.950 2.475 Y ZNF28 n/a
18 TRCN0000147979 GCAATTCATACTGGAGAGAAT pLKO.1 1438 CDS 100% 4.950 2.475 Y ZNF321P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15256 pDONR223 64.6% 61.4% 60.8% None (many diffs) n/a
2 ccsbBroad304_15256 pLX_304 0% 61.4% 60.8% V5 (many diffs) n/a
3 TRCN0000466083 GTTTGTTCTAAACATTGCGACATC pLX_317 35.1% 37.2% 37.1% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_05629 pDONR223 100% 24.5% 20.5% None (many diffs) n/a
5 ccsbBroad304_05629 pLX_304 0% 24.5% 20.5% V5 (many diffs) n/a
6 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 24.5% 20.5% V5 (many diffs) n/a
Download CSV