Transcript: Human NM_001145659.1

Homo sapiens CTAGE family member 9 (CTAGE9), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CTAGE9 (643854)
Length:
2577
CDS:
1..2334

Additional Resources:

NCBI RefSeq record:
NM_001145659.1
NBCI Gene record:
CTAGE9 (643854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145659.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350789 AGCAAGACACCTGACAATATT pLKO_005 2406 3UTR 100% 15.000 9.000 N CTAGE9 n/a
2 TRCN0000337222 AGAGCTTACAGAGCATATTAA pLKO_005 1050 CDS 100% 15.000 7.500 Y CTAGE9 n/a
3 TRCN0000337161 ATGAATTGATGGCGGATATTT pLKO_005 491 CDS 100% 15.000 7.500 Y CTAGE9 n/a
4 TRCN0000337162 CAACGCTTTCTGGACTAATTG pLKO_005 239 CDS 100% 13.200 6.600 Y CTAGE9 n/a
5 TRCN0000159554 CCAAAGATGATCTTGGTAATT pLKO.1 2003 CDS 100% 13.200 6.600 Y MIA2 n/a
6 TRCN0000158819 GAAAGAAACCTCAGTGATTTA pLKO.1 1417 CDS 100% 13.200 6.600 Y CTAGE4 n/a
7 TRCN0000161026 GAAGAGCTTACAGAGCATATT pLKO.1 1048 CDS 100% 13.200 6.600 Y CTAGE4 n/a
8 TRCN0000147704 GATGAATTGATGGCGGATATT pLKO.1 490 CDS 100% 13.200 6.600 Y CTAGE6 n/a
9 TRCN0000159081 GATGATGATAACCTGGAATTA pLKO.1 865 CDS 100% 13.200 6.600 Y CTAGE4 n/a
10 TRCN0000337160 TCGGTTAGGAGTCGGCTTTAT pLKO_005 193 CDS 100% 13.200 6.600 Y CTAGE9 n/a
11 TRCN0000161255 GCCAAAGATGATCTTGGTAAT pLKO.1 2002 CDS 100% 10.800 5.400 Y CTAGE4 n/a
12 TRCN0000160201 CCAAAGATCTTGAAGAAGAAT pLKO.1 1310 CDS 100% 5.625 2.813 Y CTAGE4 n/a
13 TRCN0000160970 GACCATCAGATTACCAATGAA pLKO.1 1705 CDS 100% 5.625 2.813 Y CTAGE4 n/a
14 TRCN0000158680 GCTTTGAAGAAACTGATTCAT pLKO.1 940 CDS 100% 5.625 2.813 Y MIA2 n/a
15 TRCN0000146679 CAATGCCTTCAGAAATGGAAT pLKO.1 1967 CDS 100% 4.950 2.475 Y CTAGE6 n/a
16 TRCN0000162203 CAGGTTATTTCCTACGAGAAA pLKO.1 1360 CDS 100% 4.950 2.475 Y CTAGE4 n/a
17 TRCN0000159985 CGATGTTTCAAATACAGCATT pLKO.1 1521 CDS 100% 4.950 2.475 Y CTAGE4 n/a
18 TRCN0000163597 CGGATGATGATAACCTGGAAT pLKO.1 863 CDS 100% 4.950 2.475 Y CTAGE15 n/a
19 TRCN0000162293 CTGAAAGAAACCTCAGTGATT pLKO.1 1415 CDS 100% 4.950 2.475 Y CTAGE15 n/a
20 TRCN0000158755 GAAATGAAACTCTACAGGAAA pLKO.1 1183 CDS 100% 4.950 2.475 Y CTAGE4 n/a
21 TRCN0000161860 GCCAAAGATCTTGAAGAAGAA pLKO.1 1309 CDS 100% 4.950 2.475 Y CTAGE4 n/a
22 TRCN0000005402 GCTATGAAGTAGAGTCATCTT pLKO.1 314 CDS 100% 4.950 2.475 Y CTAGE1 n/a
23 TRCN0000163166 GCTGAAAGAAACCTCAGTGAT pLKO.1 1414 CDS 100% 4.950 2.475 Y CTAGE15 n/a
24 TRCN0000166516 CCAGGGCAATCATATCCTGAT pLKO.1 1834 CDS 100% 4.050 2.025 Y CTAGE4 n/a
25 TRCN0000149765 GCAGGTTATTTCCTACGAGAA pLKO.1 1359 CDS 100% 4.050 2.025 Y CTAGE6 n/a
26 TRCN0000163445 GCAGGTTATTTCCTACGAGAA pLKO.1 1359 CDS 100% 4.050 2.025 Y CTAGE15 n/a
27 TRCN0000163117 GCTGAAGTATGGAAAGGACAA pLKO.1 691 CDS 100% 4.050 2.025 Y CTAGE15 n/a
28 TRCN0000148639 CCAATGAAAGAGGAGAACCAA pLKO.1 1718 CDS 100% 3.000 1.500 Y CTAGE6 n/a
29 TRCN0000162809 CCAATGAAAGAGGAGAACCAA pLKO.1 1718 CDS 100% 3.000 1.500 Y CTAGE15 n/a
30 TRCN0000146457 CCTCAAACTTTGTTGGAGGAT pLKO.1 1615 CDS 100% 2.640 1.320 Y CTAGE6 n/a
31 TRCN0000164371 CAAGATGAATTGATGGCGGAT pLKO.1 487 CDS 100% 2.160 1.080 Y CTAGE15 n/a
32 TRCN0000147443 GCAGAACAAGTTCTGAATGAT pLKO.1 763 CDS 100% 0.563 0.281 Y CTAGE6 n/a
33 TRCN0000160834 GCAGAACAAGTTCTGAATGAT pLKO.1 763 CDS 100% 0.563 0.281 Y CTAGE15 n/a
34 TRCN0000174282 CAGTTTAAGTAACTGCTGTTA pLKO.1 2466 3UTR 100% 0.495 0.248 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145659.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13596 pDONR223 100% 92.1% 87.9% None (many diffs) n/a
2 ccsbBroad304_13596 pLX_304 0% 92.1% 87.9% V5 (many diffs) n/a
3 ccsbBroadEn_10967 pDONR223 100% 88% 80.1% None (many diffs) n/a
4 ccsbBroad304_10967 pLX_304 0% 88% 80.1% V5 (many diffs) n/a
5 TRCN0000470328 CTTGCATGAATTTATTTTATTCTT pLX_317 13.8% 88% 80.1% V5 (many diffs) n/a
6 ccsbBroadEn_03960 pDONR223 100% 85.9% 75.1% None (many diffs) n/a
7 ccsbBroad304_03960 pLX_304 0% 85.9% 75.1% V5 (many diffs) n/a
8 TRCN0000469836 CGAATATCTAATGCTCGTTTGACG pLX_317 17.1% 85.9% 75.1% V5 (many diffs) n/a
9 ccsbBroadEn_13076 pDONR223 100% 85.6% 76% None (many diffs) n/a
10 ccsbBroad304_13076 pLX_304 0% 85.6% 76% V5 (many diffs) n/a
11 TRCN0000481377 AACTAGAGAATGGGATCGGTCGAA pLX_317 19.7% 85.6% 76% V5 (many diffs) n/a
12 ccsbBroadEn_10968 pDONR223 100% 79.4% 72.1% None (many diffs) n/a
13 ccsbBroad304_10968 pLX_304 0% 79.4% 72.1% V5 (many diffs) n/a
14 TRCN0000475416 ATAGTTAGCGCAGAAAAGATACGG pLX_317 11.5% 79.4% 72.1% V5 (many diffs) n/a
Download CSV