Transcript: Human NM_001193414.2

Homo sapiens tubulin alpha 8 (TUBA8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TUBA8 (51807)
Length:
1974
CDS:
227..1378

Additional Resources:

NCBI RefSeq record:
NM_001193414.2
NBCI Gene record:
TUBA8 (51807)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439231 GAACGCCTCTCCCTGGATTAT pLKO_005 491 CDS 100% 13.200 18.480 N TUBA8 n/a
2 TRCN0000108405 CGTTCACATGAGTGGGTCTAT pLKO.1 1788 3UTR 100% 4.950 6.930 N TUBA8 n/a
3 TRCN0000417850 GCCTAATCAGGAGTTTCAATT pLKO_005 1655 3UTR 100% 13.200 10.560 N TUBA8 n/a
4 TRCN0000439075 ACCGCCTCATCAGTCAGATTG pLKO_005 711 CDS 100% 10.800 7.560 N TUBA8 n/a
5 TRCN0000108408 CCACACTGGAACATTCAGATT pLKO.1 606 CDS 100% 4.950 3.465 N TUBA8 n/a
6 TRCN0000108407 GCTAGCAAGATCAACGATGAT pLKO.1 146 5UTR 100% 4.950 3.465 N TUBA8 n/a
7 TRCN0000108406 CCTACTGTAGTGGATGAGGTT pLKO.1 242 CDS 100% 2.640 1.848 N TUBA8 n/a
8 TRCN0000108409 CAAGGATGTGAATGTCGCTAT pLKO.1 1003 CDS 100% 4.050 2.430 N TUBA8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07108 pDONR223 100% 70.9% 78.6% None (many diffs) n/a
2 ccsbBroad304_07108 pLX_304 0% 70.9% 78.6% V5 (many diffs) n/a
3 TRCN0000467865 AGTTCGTGAAACATACGCCGGCAG pLX_317 34.6% 70.9% 78.6% V5 (many diffs) n/a
4 ccsbBroadEn_09386 pDONR223 100% 70.3% 79.3% None (many diffs) n/a
5 ccsbBroad304_09386 pLX_304 0% 70.3% 79.3% V5 (many diffs) n/a
6 TRCN0000465924 GTCATGGAGAAAGTCGGTGACCGG pLX_317 28.5% 70.3% 79.3% V5 (many diffs) n/a
7 ccsbBroadEn_09375 pDONR223 100% 70.1% 78.4% None (many diffs) n/a
8 ccsbBroad304_09375 pLX_304 0% 70.1% 78.4% V5 (many diffs) n/a
9 TRCN0000469142 GAGGCCACAGGCCATAAACTAATT pLX_317 29% 70.1% 78.4% V5 (many diffs) n/a
10 ccsbBroadEn_15706 pDONR223 0% 69.8% 78.7% None (many diffs) n/a
11 ccsbBroad304_15706 pLX_304 0% 69.8% 78.7% V5 (many diffs) n/a
12 TRCN0000472335 TTCTGAAATAAGACACGCCGGGCA pLX_317 37.9% 69.8% 78.7% V5 (many diffs) n/a
13 ccsbBroadEn_02413 pDONR223 100% 69.8% 78.7% None (many diffs) n/a
14 ccsbBroad304_02413 pLX_304 0% 69.8% 78.7% V5 (many diffs) n/a
15 TRCN0000466437 GGCACCAGGAAACTAGGGGTGTGT pLX_317 31.7% 69.8% 78.7% V5 (many diffs) n/a
16 ccsbBroadEn_15707 pDONR223 0% 69.7% 78.7% None (many diffs) n/a
17 ccsbBroad304_15707 pLX_304 0% 69.7% 78.7% V5 (many diffs) n/a
18 TRCN0000467476 CACCGTCGAGGCCGCTGTATAAGA pLX_317 31.7% 69.7% 78.7% V5 (many diffs) n/a
19 ccsbBroadEn_16042 pDONR223 0% 69.4% 78.6% None (many diffs) n/a
20 ccsbBroad304_16042 pLX_304 0% 69.4% 78.6% V5 (many diffs) n/a
21 ccsbBroadEn_09222 pDONR223 100% 69.4% 78.6% None (many diffs) n/a
22 ccsbBroad304_09222 pLX_304 0% 69.4% 78.6% V5 (many diffs) n/a
23 ccsbBroadEn_16043 pDONR223 0% 69.3% 78.6% None (many diffs) n/a
24 ccsbBroad304_16043 pLX_304 0% 69.3% 78.6% V5 (many diffs) n/a
25 TRCN0000465274 AATTCTCGGGCCTTAAGCACTAAC pLX_317 23.4% 69.3% 78.6% V5 (many diffs) n/a
26 ccsbBroadEn_01831 pDONR223 100% 69.1% 78.7% None (many diffs) n/a
27 ccsbBroad304_01831 pLX_304 0% 69.1% 78.7% V5 (many diffs) n/a
28 TRCN0000466264 GACTTCAAATAAATAGCTTCACTC pLX_317 23.8% 69.1% 78.7% V5 (many diffs) n/a
29 ccsbBroadEn_15708 pDONR223 0% 63.6% 54.7% None (many diffs) n/a
Download CSV