Transcript: Human NM_001193451.2

Homo sapiens transmembrane O-mannosyltransferase targeting cadherins 1 (TMTC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
TMTC1 (83857)
Length:
8846
CDS:
192..2840

Additional Resources:

NCBI RefSeq record:
NM_001193451.2
NBCI Gene record:
TMTC1 (83857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128746 CCCAACCTCATAGGATAATGT pLKO.1 2854 3UTR 100% 5.625 4.500 N TMTC1 n/a
2 TRCN0000147171 CGATTACAAGAAGTTCGAGAA pLKO.1 2805 CDS 100% 4.050 3.240 N TMTC1 n/a
3 TRCN0000149375 GAGGATAAATCCTCTGTGGTA pLKO.1 3255 3UTR 100% 0.264 0.211 N TMTC1 n/a
4 TRCN0000412975 GCTGAGCAGGAGCGGTTTAAA pLKO_005 1968 CDS 100% 15.000 10.500 N TMTC1 n/a
5 TRCN0000436579 TTGAGACCTGGAGATCTAATT pLKO_005 3143 3UTR 100% 13.200 9.240 N TMTC1 n/a
6 TRCN0000128306 GAACCAGGAATGAGTATCTAA pLKO.1 3322 3UTR 100% 5.625 3.938 N TMTC1 n/a
7 TRCN0000149558 GCCAAGGTTCACTACAACTAT pLKO.1 1638 CDS 100% 5.625 3.938 N TMTC1 n/a
8 TRCN0000129008 GCTTTGCAGATTTACCAGGAA pLKO.1 2295 CDS 100% 2.640 1.848 N TMTC1 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 5769 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09120 pDONR223 100% 87.6% 87.6% None 1_324del;1278T>C;2440G>T n/a
2 ccsbBroad304_09120 pLX_304 0% 87.6% 87.6% V5 1_324del;1278T>C;2440G>T n/a
3 ccsbBroadEn_12757 pDONR223 100% 25.7% 25.6% None 1_1956del;2015_2023delGGTACAAGC n/a
4 ccsbBroad304_12757 pLX_304 0% 25.7% 25.6% V5 1_1956del;2015_2023delGGTACAAGC n/a
5 TRCN0000472991 TAAAAGGATCACTCTCTGCAGGAC pLX_317 66.3% 25.7% 25.6% V5 1_1956del;2015_2023delGGTACAAGC n/a
Download CSV