Transcript: Mouse NM_001252498.1

Mus musculus Rap guanine nucleotide exchange factor (GEF) 6 (Rapgef6), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Rapgef6 (192786)
Length:
4843
CDS:
905..2206

Additional Resources:

NCBI RefSeq record:
NM_001252498.1
NBCI Gene record:
Rapgef6 (192786)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178091 GCTTGACTCATGGTATGTCAT pLKO.1 1405 CDS 100% 4.950 6.930 N Rapgef6 n/a
2 TRCN0000346973 GCTTGACTCATGGTATGTCAT pLKO_005 1405 CDS 100% 4.950 6.930 N Rapgef6 n/a
3 TRCN0000177845 CGGATTGTACTCTTATGGGTA pLKO.1 1889 CDS 100% 2.640 2.112 N Rapgef6 n/a
4 TRCN0000346974 CGGATTGTACTCTTATGGGTA pLKO_005 1889 CDS 100% 2.640 2.112 N Rapgef6 n/a
5 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 1160 CDS 100% 4.950 2.475 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08342 pDONR223 100% 25.9% 25.8% None (many diffs) n/a
2 ccsbBroad304_08342 pLX_304 0% 25.9% 25.8% V5 (many diffs) n/a
3 TRCN0000481587 CCCCTTCTTGCTCGCATTGACCTG pLX_317 10.9% 25.9% 25.8% V5 (many diffs) n/a
Download CSV