Transcript: Human NM_001271068.1

Homo sapiens MYC associated factor X (MAX), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
MAX (4149)
Length:
910
CDS:
206..469

Additional Resources:

NCBI RefSeq record:
NM_001271068.1
NBCI Gene record:
MAX (4149)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271068.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304477 ACGTAGGGACCACATCAAAGA pLKO_005 280 CDS 100% 4.950 6.930 N Max n/a
2 TRCN0000231548 GACAAACGGGCTCATCATAAT pLKO_005 245 CDS 100% 13.200 9.240 N MAX n/a
3 TRCN0000039867 GACCACATCAAAGACAGCTTT pLKO.1 287 CDS 100% 4.950 3.465 N MAX n/a
4 TRCN0000010374 CATCATAATGCACTGGAACGA pLKO.1 257 CDS 100% 2.640 1.848 N MAX n/a
5 TRCN0000039865 GCTCATCATAATGCACTGGAA pLKO.1 254 CDS 100% 2.640 1.848 N MAX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271068.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00977 pDONR223 100% 90.6% 90.6% None 36_37ins27 n/a
2 ccsbBroad304_00977 pLX_304 0% 90.6% 90.6% V5 36_37ins27 n/a
3 TRCN0000471511 CTCATGCCCAAAAATTGGGTAACG pLX_317 100% 90.6% 90.6% V5 36_37ins27 n/a
4 ccsbBroadEn_06564 pDONR223 100% 46.5% 38.5% None (many diffs) n/a
5 ccsbBroad304_06564 pLX_304 0% 46.5% 38.5% V5 (many diffs) n/a
6 TRCN0000473082 TAAATTTTGTCTGCTATTGACACA pLX_317 100% 46.5% 38.5% V5 (many diffs) n/a
7 ccsbBroadEn_15494 pDONR223 0% 42.9% 34.3% None (many diffs) n/a
8 ccsbBroad304_15494 pLX_304 0% 42.9% 34.3% V5 (many diffs) n/a
9 TRCN0000469052 TCAGTACTAGGAAGGTCTCTACGA pLX_317 74.2% 42.9% 34.3% V5 (many diffs) n/a
10 ccsbBroadEn_15495 pDONR223 0% 42.9% 34.3% None (many diffs) n/a
11 ccsbBroad304_15495 pLX_304 0% 42.9% 34.3% V5 (many diffs) n/a
12 TRCN0000468720 GTCTTCCACGTTCCTTTAATGCAG pLX_317 73.3% 42.9% 34.3% V5 (many diffs) n/a
13 ccsbBroadEn_00978 pDONR223 100% 40.7% 32.5% None (many diffs) n/a
14 ccsbBroad304_00978 pLX_304 0% 40.7% 32.5% V5 (many diffs) n/a
15 TRCN0000467427 CCTTCTTCGGGGACGGAAGTTACA pLX_317 69.4% 40.7% 32.5% V5 (many diffs) n/a
Download CSV