Transcript: Human NM_001282468.1

Homo sapiens golgin A8 family member M (GOLGA8M), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
GOLGA8M (653720)
Length:
5270
CDS:
99..1997

Additional Resources:

NCBI RefSeq record:
NM_001282468.1
NBCI Gene record:
GOLGA8M (653720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151320 GCAGGAGATTTGCACATTAAA pLKO.1 878 CDS 100% 15.000 7.500 Y GOLGA8IP n/a
2 TRCN0000153447 CGCAGGAGATTTGCACATTAA pLKO.1 877 CDS 100% 13.200 6.600 Y GOLGA8IP n/a
3 TRCN0000162932 GCAGTTGGAGCAGCAAGTAAA pLKO.1 1253 CDS 100% 13.200 6.600 Y GOLGA8B n/a
4 TRCN0000269218 CAGTTGGAGCAGCAAGTAAAG pLKO_005 1254 CDS 100% 10.800 5.400 Y GOLGA6L9 n/a
5 TRCN0000153167 GCCTATGTTCTGCTGTTGTTT pLKO.1 2404 3UTR 100% 5.625 2.813 Y GOLGA8G n/a
6 TRCN0000151499 CCAGACATTGAACATACAGAA pLKO.1 503 CDS 100% 4.950 2.475 Y GOLGA8IP n/a
7 TRCN0000152586 GACACAGTTGAAGGAGTCATT pLKO.1 770 CDS 100% 4.950 2.475 Y GOLGA8IP n/a
8 TRCN0000153104 GAGTGTTCTCTCTGATGTCAT pLKO.1 641 CDS 100% 4.950 2.475 Y GOLGA8IP n/a
9 TRCN0000153085 GCAACATTCATTGCAGCGTAA pLKO.1 608 CDS 100% 4.050 2.025 Y GOLGA8IP n/a
10 TRCN0000154490 GCAGCAAGTAAAGGAGCTACA pLKO.1 1262 CDS 100% 4.050 2.025 Y GOLGA8IP n/a
11 TRCN0000157310 CAGCGCATAAGTCTCCTGAAT pLKO.1 1086 CDS 100% 4.950 2.475 Y GOLGA8G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07828 pDONR223 100% 77.6% 65% None (many diffs) n/a
2 ccsbBroad304_07828 pLX_304 0% 77.6% 65% V5 (many diffs) n/a
3 TRCN0000477056 CCAAAGGCACCTCCGCCCTGATCT pLX_317 21.8% 77.6% 65% V5 (many diffs) n/a
4 ccsbBroadEn_16170 pDONR223 0% 60.3% 55% None (many diffs) n/a
5 ccsbBroad304_16170 pLX_304 0% 60.3% 55% V5 (many diffs) n/a
6 ccsbBroadEn_10341 pDONR223 100% 59.9% 54.2% None (many diffs) n/a
7 ccsbBroad304_10341 pLX_304 0% 59.9% 54.2% V5 (many diffs) n/a
8 TRCN0000476380 AGTGATAACGTTCAAGGTCGCGGA pLX_317 28.7% 59.9% 54.2% V5 (many diffs) n/a
9 ccsbBroadEn_16172 pDONR223 0% 39.8% 36% None (many diffs) n/a
10 ccsbBroad304_16172 pLX_304 0% 39.8% 36% V5 (many diffs) n/a
11 TRCN0000480289 TACTAACTTATTTTTTGACAAACC pLX_317 100% 9.2% 8.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV