Transcript: Mouse NM_001290710.1

Mus musculus early B cell factor 1 (Ebf1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ebf1 (13591)
Length:
4999
CDS:
80..1651

Additional Resources:

NCBI RefSeq record:
NM_001290710.1
NBCI Gene record:
Ebf1 (13591)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086579 CCCTGAAATGTGCCGAGTATT pLKO.1 520 CDS 100% 13.200 18.480 N Ebf1 n/a
2 TRCN0000424797 GAACAGCCTGCAAGCGATATC pLKO_005 1606 CDS 100% 10.800 15.120 N EBF1 n/a
3 TRCN0000321383 GCGCGACTGTGATCATCATAG pLKO_005 885 CDS 100% 10.800 15.120 N Ebf1 n/a
4 TRCN0000013831 GCAGTCTCTGATAACATGTTT pLKO.1 758 CDS 100% 5.625 7.875 N EBF1 n/a
5 TRCN0000321455 GGATTCTGCTACGAAAGTTAT pLKO_005 1689 3UTR 100% 13.200 10.560 N Ebf1 n/a
6 TRCN0000374141 GCCTTCTAACCTGCGGAAATC pLKO_005 253 CDS 100% 10.800 8.640 N Ebf1 n/a
7 TRCN0000086580 CCTGGCAGTCTCTGATAACAT pLKO.1 754 CDS 100% 5.625 4.500 N Ebf1 n/a
8 TRCN0000086578 GCTACGAAAGTTATCTGACAT pLKO.1 1696 3UTR 100% 4.950 3.960 N Ebf1 n/a
9 TRCN0000321382 GATGGGTTACAGGTCATATTC pLKO_005 920 CDS 100% 13.200 9.240 N Ebf1 n/a
10 TRCN0000435286 GATGGGTTACAGGTCATATTC pLKO_005 920 CDS 100% 13.200 9.240 N EBF1 n/a
11 TRCN0000374050 TTAAGAGGAATCACACAATAA pLKO_005 1751 3UTR 100% 13.200 9.240 N Ebf1 n/a
12 TRCN0000321454 AGAGGTTACAGAAGGTCATTC pLKO_005 1125 CDS 100% 10.800 7.560 N Ebf1 n/a
13 TRCN0000086582 CCAGAGGTTACAGAAGGTCAT pLKO.1 1123 CDS 100% 4.050 2.835 N Ebf1 n/a
14 TRCN0000013829 CCCTCAGATCCAGTGATAATT pLKO.1 608 CDS 100% 15.000 9.000 N EBF1 n/a
15 TRCN0000013832 GCCATAGTGTATGAAGGCCAA pLKO.1 491 CDS 100% 2.160 1.296 N EBF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00472 pDONR223 100% 83.4% 88.3% None (many diffs) n/a
2 TRCN0000470042 CCGTCATAAGGGACACTGTAAAAG pLX_317 26.1% 83.4% 88.3% V5 (many diffs) n/a
3 ccsbBroad304_00472 pLX_304 37.5% 83.4% 68.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV