Transcript: Mouse NM_001313724.1

Mus musculus tubulin, alpha 4A (Tuba4a), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tuba4a (22145)
Length:
2329
CDS:
792..1679

Additional Resources:

NCBI RefSeq record:
NM_001313724.1
NBCI Gene record:
Tuba4a (22145)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323328 ATATTGAGCGTCCAACCTATA pLKO_005 985 CDS 100% 10.800 7.560 N TUBA1A n/a
2 TRCN0000091961 CCACAAGTTTGACTTGATGTA pLKO.1 1508 CDS 100% 4.950 3.465 N Tuba4a n/a
3 TRCN0000316178 CCACAAGTTTGACTTGATGTA pLKO_005 1508 CDS 100% 4.950 3.465 N Tuba4a n/a
4 TRCN0000091959 GCCTACTGTAATCGATGAGAT pLKO.1 312 5UTR 100% 4.950 3.465 N Tuba4a n/a
5 TRCN0000349155 GCCTACTGTAATCGATGAGAT pLKO_005 312 5UTR 100% 4.950 3.465 N Tuba4a n/a
6 TRCN0000091960 GCTACCTATGCACCAGTCATT pLKO.1 1140 CDS 100% 4.950 3.465 N Tuba4a n/a
7 TRCN0000316177 GCTACCTATGCACCAGTCATT pLKO_005 1140 CDS 100% 4.950 3.465 N Tuba4a n/a
8 TRCN0000091962 ACCTAGATATTGAGCGTCCAA pLKO.1 979 CDS 100% 2.640 1.848 N Tuba4a n/a
9 TRCN0000316176 ACCTAGATATTGAGCGTCCAA pLKO_005 979 CDS 100% 2.640 1.848 N Tuba4a n/a
10 TRCN0000091958 GCGTCATTGAACACTGAGGAT pLKO.1 2119 3UTR 100% 2.640 1.848 N Tuba4a n/a
11 TRCN0000420485 TGCCTGCTGTACCGTGGAGAT pLKO_005 1278 CDS 100% 1.350 0.810 N TUBA4A n/a
12 TRCN0000248506 CCATTGGCAAGGAGATCATTG pLKO_005 425 5UTR 100% 10.800 5.400 Y Tuba1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07108 pDONR223 100% 60.9% 65.8% None (many diffs) n/a
2 ccsbBroad304_07108 pLX_304 0% 60.9% 65.8% V5 (many diffs) n/a
3 TRCN0000467865 AGTTCGTGAAACATACGCCGGCAG pLX_317 34.6% 60.9% 65.8% V5 (many diffs) n/a
4 ccsbBroadEn_02413 pDONR223 100% 56.4% 64.3% None (many diffs) n/a
5 ccsbBroad304_02413 pLX_304 0% 56.4% 64.3% V5 (many diffs) n/a
6 TRCN0000466437 GGCACCAGGAAACTAGGGGTGTGT pLX_317 31.7% 56.4% 64.3% V5 (many diffs) n/a
7 ccsbBroadEn_15707 pDONR223 0% 56.4% 64.3% None (many diffs) n/a
8 ccsbBroad304_15707 pLX_304 0% 56.4% 64.3% V5 (many diffs) n/a
9 TRCN0000467476 CACCGTCGAGGCCGCTGTATAAGA pLX_317 31.7% 56.4% 64.3% V5 (many diffs) n/a
10 ccsbBroadEn_15706 pDONR223 0% 56.3% 64.3% None (many diffs) n/a
11 ccsbBroad304_15706 pLX_304 0% 56.3% 64.3% V5 (many diffs) n/a
12 TRCN0000472335 TTCTGAAATAAGACACGCCGGGCA pLX_317 37.9% 56.3% 64.3% V5 (many diffs) n/a
13 ccsbBroadEn_09222 pDONR223 100% 55.8% 63.9% None (many diffs) n/a
14 ccsbBroad304_09222 pLX_304 0% 55.8% 63.9% V5 (many diffs) n/a
15 ccsbBroadEn_16043 pDONR223 0% 55.8% 63.9% None (many diffs) n/a
16 ccsbBroad304_16043 pLX_304 0% 55.8% 63.9% V5 (many diffs) n/a
17 TRCN0000465274 AATTCTCGGGCCTTAAGCACTAAC pLX_317 23.4% 55.8% 63.9% V5 (many diffs) n/a
18 ccsbBroadEn_01831 pDONR223 100% 55.8% 63.8% None (many diffs) n/a
19 ccsbBroad304_01831 pLX_304 0% 55.8% 63.8% V5 (many diffs) n/a
20 TRCN0000466264 GACTTCAAATAAATAGCTTCACTC pLX_317 23.8% 55.8% 63.8% V5 (many diffs) n/a
21 ccsbBroadEn_16042 pDONR223 0% 55.7% 63.9% None (many diffs) n/a
22 ccsbBroad304_16042 pLX_304 0% 55.7% 63.9% V5 (many diffs) n/a
23 ccsbBroadEn_09386 pDONR223 100% 54.6% 63.1% None (many diffs) n/a
24 ccsbBroad304_09386 pLX_304 0% 54.6% 63.1% V5 (many diffs) n/a
25 TRCN0000465924 GTCATGGAGAAAGTCGGTGACCGG pLX_317 28.5% 54.6% 63.1% V5 (many diffs) n/a
26 ccsbBroadEn_09375 pDONR223 100% 54.3% 62.4% None (many diffs) n/a
27 ccsbBroad304_09375 pLX_304 0% 54.3% 62.4% V5 (many diffs) n/a
28 TRCN0000469142 GAGGCCACAGGCCATAAACTAATT pLX_317 29% 54.3% 62.4% V5 (many diffs) n/a
Download CSV