Transcript: Human NM_001319305.2

Homo sapiens abhydrolase domain containing 18 (ABHD18), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ABHD18 (80167)
Length:
5671
CDS:
409..1557

Additional Resources:

NCBI RefSeq record:
NM_001319305.2
NBCI Gene record:
ABHD18 (80167)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319305.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263935 GCCAAAGAAGATGCCTATATT pLKO_005 1378 CDS 100% 15.000 21.000 N ABHD18 n/a
2 TRCN0000129188 CGAACAGGAGTTCGAAGTTTA pLKO.1 1402 CDS 100% 1.320 1.848 N ABHD18 n/a
3 TRCN0000263933 TCATACCACCTACTTAGTAAA pLKO_005 1234 CDS 100% 13.200 10.560 N ABHD18 n/a
4 TRCN0000263931 GACAAGCTAACTAACCTTAAT pLKO_005 1018 CDS 100% 13.200 9.240 N ABHD18 n/a
5 TRCN0000263934 TGGAACAGGAGATCATCATTA pLKO_005 504 CDS 100% 13.200 9.240 N ABHD18 n/a
6 TRCN0000147139 CAGACAAGCTAACTAACCTTA pLKO.1 1016 CDS 100% 4.950 3.465 N ABHD18 n/a
7 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3231 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4372 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4372 3UTR 100% 4.950 2.475 Y C19orf31 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2601 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2943 3UTR 100% 10.800 5.400 Y SMIM11A n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4370 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4370 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4370 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2214 3UTR 100% 4.950 2.475 Y ERAP2 n/a
16 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2380 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319305.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12675 pDONR223 100% 86.8% 86.9% None 454_555del;1098_1146delinsG n/a
2 ccsbBroad304_12675 pLX_304 0% 86.8% 86.9% V5 454_555del;1098_1146delinsG n/a
3 TRCN0000475662 CCTCAGTGAGCCAAGCCACAAATC pLX_317 28.2% 86.8% 86.9% V5 454_555del;1098_1146delinsG n/a
4 ccsbBroadEn_12676 pDONR223 100% 83.9% 84% None 1_135del;1098_1146delinsG n/a
5 ccsbBroad304_12676 pLX_304 0% 83.9% 84% V5 1_135del;1098_1146delinsG n/a
6 TRCN0000480245 AGGGTAGTTCTAAACACTCTTCTT pLX_317 29.2% 83.9% 84% V5 1_135del;1098_1146delinsG n/a
Download CSV