Transcript: Human NM_001320855.1

Homo sapiens actin alpha 2, smooth muscle (ACTA2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
ACTA2 (59)
Length:
1722
CDS:
400..1533

Additional Resources:

NCBI RefSeq record:
NM_001320855.1
NBCI Gene record:
ACTA2 (59)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116932 CCCGATAGAACATGGCATCAT pLKO.1 612 CDS 100% 4.950 6.930 N ACTA2 n/a
2 TRCN0000300414 CCCGATAGAACATGGCATCAT pLKO_005 612 CDS 100% 4.950 6.930 N ACTA2 n/a
3 TRCN0000116934 CGATAGAACATGGCATCATCA pLKO.1 614 CDS 100% 4.950 6.930 N ACTA2 n/a
4 TRCN0000116935 GCGTGAGATTGTCCGGGACAT pLKO.1 1020 CDS 100% 1.350 1.890 N ACTA2 n/a
5 TRCN0000300416 GCGTGAGATTGTCCGGGACAT pLKO_005 1020 CDS 100% 1.350 1.890 N ACTA2 n/a
6 TRCN0000116936 CCTTGAGAAGAGTTACGAGTT pLKO.1 1110 CDS 100% 4.050 2.835 N ACTA2 n/a
7 TRCN0000300413 CCTTGAGAAGAGTTACGAGTT pLKO_005 1110 CDS 100% 4.050 2.835 N ACTA2 n/a
8 TRCN0000116933 GCAAGTGATCACCATCGGAAA pLKO.1 1140 CDS 100% 4.050 2.835 N ACTA2 n/a
9 TRCN0000300415 GCAAGTGATCACCATCGGAAA pLKO_005 1140 CDS 100% 4.050 2.835 N ACTA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00014 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00014 pLX_304 0% 100% 100% V5 (not translated due to prior stop codon) n/a
3 TRCN0000467679 GCTACTGCTTTGAGGGTTATAACT pLX_317 37.9% 100% 100% V5 (not translated due to prior stop codon) n/a
4 ccsbBroadEn_00015 pDONR223 100% 85.6% 98.4% None (many diffs) n/a
5 ccsbBroad304_00015 pLX_304 0% 85.6% 98.4% V5 (many diffs) n/a
6 TRCN0000468012 TCTATATTCTTCCCTCACTCATAA pLX_317 37.9% 85.6% 98.4% V5 (many diffs) n/a
7 ccsbBroadEn_15351 pDONR223 0% 82.2% 93.6% None (many diffs) n/a
8 ccsbBroad304_15351 pLX_304 0% 82.2% 93.6% V5 (many diffs) n/a
9 ccsbBroadEn_13808 pDONR223 100% 82.2% 93.1% None (many diffs) n/a
10 ccsbBroad304_13808 pLX_304 0% 82.2% 93.1% V5 (not translated due to frame shift) (many diffs) n/a
11 TRCN0000471742 AATGGGAGTTCTCACGTCAGGTCC pLX_317 44.8% 82.2% 93.1% V5 (not translated due to frame shift) (many diffs) n/a
12 ccsbBroadEn_05764 pDONR223 100% 82.1% 93.6% None (many diffs) n/a
13 ccsbBroad304_05764 pLX_304 0% 82.1% 93.6% V5 (many diffs) n/a
14 TRCN0000466781 AATTGTGGTGCTTGTTGCCGCCTG pLX_317 31.7% 82.1% 93.6% V5 (many diffs) n/a
15 ccsbBroadEn_05763 pDONR223 100% 82% 93.1% None (many diffs) n/a
16 ccsbBroad304_05763 pLX_304 53.1% 82% 93.1% V5 (many diffs) n/a
17 TRCN0000470279 TCAAGCCTGGAACGGGCTCACGTC pLX_317 31.7% 82% 93.1% V5 (many diffs) n/a
Download CSV