Transcript: Human NM_001348720.1

Homo sapiens zinc finger protein 439 (ZNF439), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
ZNF439 (90594)
Length:
2642
CDS:
260..1720

Additional Resources:

NCBI RefSeq record:
NM_001348720.1
NBCI Gene record:
ZNF439 (90594)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434401 ATGCAAACAAGCATTCAATTA pLKO_005 2145 3UTR 100% 13.200 10.560 N ZNF439 n/a
2 TRCN0000015598 GCATGTGAATGTCAGGAATAT pLKO.1 659 CDS 100% 13.200 9.240 N ZNF439 n/a
3 TRCN0000015599 GTCCAGAACTTTCGATTTCAT pLKO.1 1652 CDS 100% 5.625 3.938 N ZNF439 n/a
4 TRCN0000015601 CTTCAGATATGTCCAGAACTT pLKO.1 1642 CDS 100% 4.950 3.465 N ZNF439 n/a
5 TRCN0000430414 TTCTGGAACCTGACCTCTATA pLKO_005 374 CDS 100% 13.200 7.920 N ZNF439 n/a
6 TRCN0000015602 GCCAAGTCATTTCAAAGACAT pLKO.1 1316 CDS 100% 4.950 2.970 N ZNF439 n/a
7 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1785 3UTR 100% 15.000 7.500 Y ZNF443 n/a
8 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1785 3UTR 100% 15.000 7.500 Y Zfp97 n/a
9 TRCN0000243739 GAATGTAAACAATGTGGTAAA pLKO_005 947 CDS 100% 10.800 5.400 Y Gm14411 n/a
10 TRCN0000015600 GCTGGATATTTCCCAGAAGAA pLKO.1 325 CDS 100% 4.950 2.475 Y ZNF439 n/a
11 TRCN0000154837 GAAGACAGTCATTGTGGAGAA pLKO.1 491 CDS 100% 4.050 2.025 Y ZNF763 n/a
12 TRCN0000147730 GAATGTAAGGATTGTGGGAAA pLKO.1 2218 3UTR 100% 4.050 2.025 Y ZNF700 n/a
13 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1603 CDS 100% 13.200 6.600 Y Zfp977 n/a
14 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 2129 3UTR 100% 5.625 2.813 Y ZNF570 n/a
15 TRCN0000107953 GCTGTGAACTTCACCCAGGAA pLKO.1 293 CDS 100% 2.640 1.320 Y ZNF799 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000471005 ACATCAGGGGTCAATTGTCCTCTC pLX_317 27.5% 86.1% 79% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15236 pDONR223 77.6% 74.8% 66.1% None (many diffs) n/a
3 ccsbBroad304_15236 pLX_304 0% 74.8% 66.1% V5 (many diffs) n/a
4 ccsbBroadEn_15207 pDONR223 64.2% 74.4% 74.2% None (many diffs) n/a
5 ccsbBroad304_15207 pLX_304 0% 74.4% 74.2% V5 (many diffs) n/a
6 TRCN0000479573 TCAACGTGAACCTTCGTTCCTCGT pLX_317 53.6% 44.7% 44.8% V5 (not translated due to frame shift) 1_369del;1023_1458del n/a
7 ccsbBroadEn_01804 pDONR223 100% 25.8% 22.6% None (many diffs) n/a
8 ccsbBroad304_01804 pLX_304 0% 25.8% 22.6% V5 (many diffs) n/a
Download CSV