Transcript: Human NM_001351365.1

Homo sapiens NBPF member 19 (NBPF19), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
NBPF19 (101060226)
Length:
13190
CDS:
36..11567

Additional Resources:

NCBI RefSeq record:
NM_001351365.1
NBCI Gene record:
NBPF19 (101060226)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352961 CTGAGGAGCTCAGGCAATATA pLKO_005 301 CDS 100% 15.000 7.500 Y NBPF11 n/a
2 TRCN0000244546 CTTGACGTGGACAGAATTAAA pLKO_005 1461 CDS 100% 15.000 7.500 Y NBPF11 n/a
3 TRCN0000255811 GAGGAGCTCAGGCAATATAAA pLKO_005 303 CDS 100% 15.000 7.500 Y NBPF15 n/a
4 TRCN0000244560 GAGGATGCTGTACACATTATT pLKO_005 783 CDS 100% 15.000 7.500 Y NBPF10 n/a
5 TRCN0000369471 TCTTGACGTGGACAGAATTAA pLKO_005 1460 CDS 100% 15.000 7.500 Y NBPF14 n/a
6 TRCN0000242329 TGAGGAGCTCAGGCAATATAA pLKO_005 302 CDS 100% 15.000 7.500 Y NBPF9 n/a
7 TRCN0000364789 AGGATGCTGTACACATTATTC pLKO_005 784 CDS 100% 13.200 6.600 Y NBPF14 n/a
8 TRCN0000242430 AGTCCTGGGATGAAGGTTATT pLKO_005 898 CDS 100% 13.200 6.600 Y NBPF11 n/a
9 TRCN0000161314 GACTCACTGGATAGATGTTAT pLKO.1 1122 CDS 100% 13.200 6.600 Y NBPF1 n/a
10 TRCN0000344135 GCATGTCTCTGAGCTTCTATA pLKO_005 11875 3UTR 100% 13.200 6.600 Y NBPF15 n/a
11 TRCN0000244559 GCCCTACAGCAGTGCTGTTTA pLKO_005 1409 CDS 100% 13.200 6.600 Y NBPF10 n/a
12 TRCN0000161173 GCTGTTGACATGGATGAAATT pLKO.1 1965 CDS 100% 13.200 6.600 Y NBPF14 n/a
13 TRCN0000352962 GGAGTGATCAGTCGGACATTT pLKO_005 11795 3UTR 100% 13.200 6.600 Y NBPF11 n/a
14 TRCN0000282774 GTCCTGGGATGAAGGTTATTC pLKO_005 899 CDS 100% 13.200 6.600 Y NBPF11 n/a
15 TRCN0000255809 TAGTTTGTCCATCACCATTAT pLKO_005 12721 3UTR 100% 13.200 6.600 Y NBPF15 n/a
16 TRCN0000242325 ACGAGAGCTGACCCAGTTAAG pLKO_005 344 CDS 100% 10.800 5.400 Y NBPF9 n/a
17 TRCN0000242327 ATTCGACTCCTTCAGGTTATC pLKO_005 5758 CDS 100% 10.800 5.400 Y NBPF9 n/a
18 TRCN0000265705 GCATATCAGCTTCGCCCTTTA pLKO_005 11468 CDS 100% 10.800 5.400 Y NBPF15 n/a
19 TRCN0000344136 TGTTATTCGACTCCGTCAATG pLKO_005 11385 CDS 100% 10.800 5.400 Y NBPF15 n/a
20 TRCN0000164466 CAGCAGCACATTTCACTCATT pLKO.1 965 CDS 100% 4.950 2.475 Y NBPF14 n/a
21 TRCN0000146474 CCTGAGTTTCATAGGAGGTAA pLKO.1 12320 3UTR 100% 4.950 2.475 Y NBPF15 n/a
22 TRCN0000163889 CCTGAGTTTCATAGGAGGTAA pLKO.1 12320 3UTR 100% 4.950 2.475 Y NBPF14 n/a
23 TRCN0000161501 GACGATGAAGATGTTCAAGTT pLKO.1 543 CDS 100% 4.950 2.475 Y NBPF14 n/a
24 TRCN0000128566 GATGACGATGAAGATGTTCAA pLKO.1 540 CDS 100% 4.950 2.475 Y NBPF15 n/a
25 TRCN0000127801 GCAGAGACAATGCTGTGAGTT pLKO.1 12666 3UTR 100% 4.950 2.475 Y NBPF15 n/a
26 TRCN0000165817 GCTGTTGACATAGGCAGACAT pLKO.1 1008 CDS 100% 4.950 2.475 Y NBPF14 n/a
27 TRCN0000181020 CTGGATGAGAAAGAGCCTGAA pLKO.1 1317 CDS 100% 4.050 2.025 Y NBPF8 n/a
28 TRCN0000183501 GCTGTACACATTATTCCAGAA pLKO.1 789 CDS 100% 4.050 2.025 Y NBPF9 n/a
29 TRCN0000163782 GCTGTTTACTCATTGGAGGAA pLKO.1 1422 CDS 100% 2.640 1.320 Y NBPF1 n/a
30 TRCN0000172811 GCAGGACTCACTGGATAGATT pLKO.1 1118 CDS 100% 5.625 2.813 Y NBPF3 n/a
31 TRCN0000146826 CCGTCAATGTACTTTGAACAA pLKO.1 11397 CDS 100% 4.950 2.475 Y NBPF15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09966 pDONR223 100% 16.6% 15.6% None (many diffs) n/a
2 ccsbBroad304_09966 pLX_304 0% 16.6% 15.6% V5 (many diffs) n/a
3 TRCN0000476622 TTTTACCGTGCTGGCCAAGGACTT pLX_317 19.5% 16.6% 15.6% V5 (many diffs) n/a
4 ccsbBroadEn_15343 pDONR223 79.7% 15.2% 14.8% None (many diffs) n/a
5 ccsbBroad304_15343 pLX_304 0% 15.2% 14.8% V5 (many diffs) n/a
6 TRCN0000476676 CTCGGTCCAAATACGACCGTGACC pLX_317 14.4% 15.2% 14.8% V5 (many diffs) n/a
7 ccsbBroadEn_12247 pDONR223 100% 14.9% 13.9% None (many diffs) n/a
8 ccsbBroad304_12247 pLX_304 0% 14.9% 13.9% V5 (many diffs) n/a
9 TRCN0000475390 TTACACTGAACGGGCTATGATCAG pLX_317 19.6% 14.9% 13.9% V5 (many diffs) n/a
10 ccsbBroadEn_15282 pDONR223 73.8% 11.6% 7.1% None (many diffs) n/a
11 ccsbBroad304_15282 pLX_304 0% 11.6% 7.1% V5 (many diffs) n/a
12 TRCN0000469491 AAATCTAACGTTAGACAGGGAAAT pLX_317 16.1% 8.3% 8.2% V5 (not translated due to frame shift) (many diffs) n/a
13 ccsbBroadEn_12795 pDONR223 100% 6.5% 4.6% None (many diffs) n/a
14 ccsbBroad304_12795 pLX_304 0% 6.5% 4.6% V5 (many diffs) n/a
15 TRCN0000466247 ATCAGCAGGTCACACTGTTGAGTG pLX_317 41.2% 6.5% 4.6% V5 (many diffs) n/a
Download CSV