Transcript: Human NM_001351834.2

Homo sapiens ATM serine/threonine kinase (ATM), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
ATM (472)
Length:
13003
CDS:
239..9409

Additional Resources:

NCBI RefSeq record:
NM_001351834.2
NBCI Gene record:
ATM (472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149033 GACCTACCTGAATAACACAC pXPR_003 TGG 5161 56% 35 1.0665 ATM ATM 77531
2 BRDN0001146099 TCTACCCCAACAGCGACATG pXPR_003 GGG 1342 15% 11 0.7458 ATM ATM 77530
3 BRDN0001149518 TCATCACCAAGTTCGCATGT pXPR_003 TGG 3259 36% 23 0.2508 ATM ATM 77529
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351834.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245110 TCGTGTATTAGTGAGTATAAT pLKO_005 11421 3UTR 100% 15.000 21.000 N ATM n/a
2 TRCN0000196661 GCCATATTCTTTCCGTCTATT pLKO.1 6459 CDS 100% 13.200 18.480 N ATM n/a
3 TRCN0000196966 GCTAAGTCACTGACCCATATT pLKO.1 12318 3UTR 100% 13.200 18.480 N ATM n/a
4 TRCN0000038657 GCACTGAAAGAGGATCGTAAA pLKO.1 7598 CDS 100% 10.800 15.120 N ATM n/a
5 TRCN0000038658 CGTGTCTTAATGAGACTACAA pLKO.1 9260 CDS 100% 4.950 6.930 N ATM n/a
6 TRCN0000039952 GCTAGAATAATTCATGCTGTT pLKO.1 800 CDS 100% 4.050 5.670 N ATM n/a
7 TRCN0000195732 CTGGTGACTATACAGTCATTT pLKO.1 8276 CDS 100% 1.320 1.848 N ATM n/a
8 TRCN0000039949 GCACGCTAGAACCTACCAAAT pLKO.1 3039 CDS 100% 10.800 8.640 N ATM n/a
9 TRCN0000038654 CCTGCCAACATACTTTAAGTA pLKO.1 9475 3UTR 100% 5.625 4.500 N ATM n/a
10 TRCN0000038655 GCCGTCAACTAGAACATGATA pLKO.1 273 CDS 100% 5.625 4.500 N ATM n/a
11 TRCN0000245106 GCCGTCAACTAGAACATGATA pLKO_005 273 CDS 100% 5.625 4.500 N ATM n/a
12 TRCN0000194816 CACAAACTCTTGGTCATTATA pLKO.1 12692 3UTR 100% 15.000 10.500 N ATM n/a
13 TRCN0000245107 CGAGATCCTGAAACAATTAAA pLKO_005 341 CDS 100% 15.000 10.500 N ATM n/a
14 TRCN0000194969 CAAACGAAATCTCAGTGATAT pLKO.1 9211 CDS 100% 13.200 9.240 N ATM n/a
15 TRCN0000039950 CCTGAAACTTTGGATGAAATT pLKO.1 3659 CDS 100% 13.200 9.240 N ATM n/a
16 TRCN0000038656 GCCATAATTCAGGGTAGTTTA pLKO.1 1766 CDS 100% 13.200 9.240 N ATM n/a
17 TRCN0000245109 TGGGTGTGATCTTCAGTATAT pLKO_005 9401 CDS 100% 13.200 9.240 N ATM n/a
18 TRCN0000245108 TGGTCAAATACTTCATCAAAT pLKO_005 537 CDS 100% 13.200 9.240 N ATM n/a
19 TRCN0000195474 CCTACTTTGTGCAGGTCATAC pLKO.1 12640 3UTR 100% 10.800 7.560 N ATM n/a
20 TRCN0000194686 CCTGCGATTGTTAACATCAAA pLKO.1 2647 CDS 100% 5.625 3.938 N ATM n/a
21 TRCN0000039948 CCTTTCATTCAGCCTTTAGAA pLKO.1 9429 3UTR 100% 5.625 3.938 N ATM n/a
22 TRCN0000194861 CCAAGGTCTATGATATGCTTA pLKO.1 4185 CDS 100% 4.950 3.465 N ATM n/a
23 TRCN0000039951 GCCTCCAATTCTTCACAGTAA pLKO.1 2023 CDS 100% 4.950 3.465 N ATM n/a
24 TRCN0000010299 TGATGGTCTTAAGGAACATCT pLKO.1 9579 3UTR 100% 4.950 3.465 N ATM n/a
25 TRCN0000196335 GTATTACCTTTCGTGGTATAA pLKO.1 1704 CDS 100% 13.200 7.920 N ATM n/a
26 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 9652 3UTR 100% 4.950 2.475 Y ERAP2 n/a
27 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 9653 3UTR 100% 13.200 6.600 Y LIAS n/a
28 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 11145 3UTR 100% 5.625 2.813 Y KLHL30 n/a
29 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 10980 3UTR 100% 4.950 2.475 Y C16orf89 n/a
30 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 10945 3UTR 100% 4.950 2.475 Y CCNJL n/a
31 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 10907 3UTR 100% 0.495 0.248 Y C11orf44 n/a
32 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 11145 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351834.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10689 pDONR223 100% 4.2% 4.2% None 1_4044del;4438_9168del n/a
2 ccsbBroad304_10689 pLX_304 97.8% 4.2% 4.2% V5 1_4044del;4438_9168del n/a
3 TRCN0000471841 AACTATAAGACCCGGATATGCACT pLX_317 100% 4.2% 4.2% V5 1_4044del;4438_9168del n/a
4 ccsbBroadEn_10688 pDONR223 100% 3.6% 3.5% None 332_333insTA;335_9168del n/a
5 ccsbBroad304_10688 pLX_304 97.4% 3.6% 3.5% V5 332_333insTA;335_9168del n/a
6 TRCN0000491887 TGGTATTGATTCTCGAAGGTGCCG pLX_317 91.8% 3.6% 3.5% V5 332_333insTA;335_9168del n/a
Download CSV