Transcript: Human NM_002314.4

Homo sapiens LIM domain kinase 1 (LIMK1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
LIMK1 (3984)
Length:
3355
CDS:
188..2131

Additional Resources:

NCBI RefSeq record:
NM_002314.4
NBCI Gene record:
LIMK1 (3984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002314.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199497 GCAACAGGTATCGAGGACTCT pLKO.1 2658 3UTR 100% 2.640 3.696 N LIMK1 n/a
2 TRCN0000199315 CCCTGAGCTCTCCGGCTTATA pLKO.1 1002 CDS 100% 4.400 3.520 N LIMK1 n/a
3 TRCN0000199421 CGGAGACCGGATCTTGGAAAT pLKO.1 844 CDS 100% 10.800 7.560 N LIMK1 n/a
4 TRCN0000000825 CAGTTGAGCATCTAGGAAGTA pLKO.1 3162 3UTR 100% 4.950 3.465 N LIMK1 n/a
5 TRCN0000010555 CTACCTCCACTCCATGAACAT pLKO.1 1534 CDS 100% 4.950 3.465 N LIMK1 n/a
6 TRCN0000000826 GACGAGATTGACCTGCTGATT pLKO.1 896 CDS 100% 4.950 3.465 N LIMK1 n/a
7 TRCN0000199876 GATCGTCCTGTGCGAGATCAT pLKO.1 1795 CDS 100% 4.950 3.465 N LIMK1 n/a
8 TRCN0000010554 CTACAAGGACAAGAGGCTCAA pLKO.1 1396 CDS 100% 4.050 2.835 N LIMK1 n/a
9 TRCN0000010553 GAAGAACGTATGGGAGAGGAA pLKO.1 221 CDS 100% 2.640 1.848 N LIMK1 n/a
10 TRCN0000199751 GCACTGCTACTACCAGACTGT pLKO.1 592 CDS 100% 2.640 1.848 N LIMK1 n/a
11 TRCN0000199627 GCCGCAGCTATGATGAGAAGG pLKO.1 1755 CDS 100% 1.350 0.945 N LIMK1 n/a
12 TRCN0000199691 CCATGGGTGCTCTGAGCAAAT pLKO.1 439 CDS 100% 10.800 6.480 N LIMK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002314.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488412 GAAAGGACCTGGCCTCAACGTAAA pLX_317 15.1% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000489759 TAGACGATTGGGTTGGAAGCTCTG pLX_317 21% 100% 100% V5 (not translated due to prior stop codon) n/a
3 TRCN0000489480 GAAATCAATTATGGTCTTATGGAT pLX_317 18.2% 99.9% 100% V5 1353C>T n/a
4 ccsbBroadEn_14689 pDONR223 78.2% 99.5% 32.5% None (many diffs) n/a
5 ccsbBroad304_14689 pLX_304 0% 99.5% 32.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000471921 TGAGAAAATAATCTTAGATAAACA pLX_317 19.8% 99.5% 32.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV