Transcript: Human NM_005930.4

Homo sapiens MIA SH3 domain ER export factor 2 (MIA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MIA2 (4253)
Length:
3630
CDS:
76..2490

Additional Resources:

NCBI RefSeq record:
NM_005930.4
NBCI Gene record:
MIA2 (4253)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005930.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159453 GCCCAAAGCAACAAATTAATA pLKO.1 3049 3UTR 100% 15.000 12.000 N MIA2 n/a
2 TRCN0000159155 GCACGGTTTCTTTATTGCTTT pLKO.1 3169 3UTR 100% 4.950 3.960 N MIA2 n/a
3 TRCN0000160064 CCAATAACTTTGAGGTGCAAA pLKO.1 2950 3UTR 100% 4.950 3.465 N MIA2 n/a
4 TRCN0000158515 CCAGATTCTAATCTTTATGGT pLKO.1 169 CDS 100% 3.000 2.100 N MIA2 n/a
5 TRCN0000165720 CCTCAGGTTTGATTCCACCTT pLKO.1 2423 CDS 100% 2.640 1.848 N MIA2 n/a
6 TRCN0000161286 GCTCTAATGCTTTCTGGACTA pLKO.1 310 CDS 100% 4.050 2.430 N MIA2 n/a
7 TRCN0000162381 CAAGGGCAGATTATTTCCCAT pLKO.1 1423 CDS 100% 2.640 1.584 N MIA2 n/a
8 TRCN0000337222 AGAGCTTACAGAGCATATTAA pLKO_005 1119 CDS 100% 15.000 7.500 Y CTAGE9 n/a
9 TRCN0000337161 ATGAATTGATGGCGGATATTT pLKO_005 563 CDS 100% 15.000 7.500 Y CTAGE9 n/a
10 TRCN0000159554 CCAAAGATGATCTTGGTAATT pLKO.1 2072 CDS 100% 13.200 6.600 Y MIA2 n/a
11 TRCN0000161026 GAAGAGCTTACAGAGCATATT pLKO.1 1117 CDS 100% 13.200 6.600 Y CTAGE4 n/a
12 TRCN0000147704 GATGAATTGATGGCGGATATT pLKO.1 562 CDS 100% 13.200 6.600 Y CTAGE6 n/a
13 TRCN0000337160 TCGGTTAGGAGTCGGCTTTAT pLKO_005 268 CDS 100% 13.200 6.600 Y CTAGE9 n/a
14 TRCN0000160201 CCAAAGATCTTGAAGAAGAAT pLKO.1 1379 CDS 100% 5.625 2.813 Y CTAGE4 n/a
15 TRCN0000160970 GACCATCAGATTACCAATGAA pLKO.1 1774 CDS 100% 5.625 2.813 Y CTAGE4 n/a
16 TRCN0000005400 GCTGAAAGAAACCTCAATGAT pLKO.1 1483 CDS 100% 5.625 2.813 Y CTAGE1 n/a
17 TRCN0000158680 GCTTTGAAGAAACTGATTCAT pLKO.1 1009 CDS 100% 5.625 2.813 Y MIA2 n/a
18 TRCN0000146679 CAATGCCTTCAGAAATGGAAT pLKO.1 2036 CDS 100% 4.950 2.475 Y CTAGE6 n/a
19 TRCN0000158611 CAGATTATTTCCCATGAGAAA pLKO.1 1429 CDS 100% 4.950 2.475 Y MIA2 n/a
20 TRCN0000166046 CCACAGCAAGAAACCTGACAA pLKO.1 2473 CDS 100% 4.950 2.475 Y CTAGE4 n/a
21 TRCN0000005399 CGGATGATGATAACTTGGAAT pLKO.1 932 CDS 100% 4.950 2.475 Y CTAGE1 n/a
22 TRCN0000158647 CGGATGATGATAACTTGGAAT pLKO.1 932 CDS 100% 4.950 2.475 Y MIA2 n/a
23 TRCN0000158825 GCAGATTATTTCCCATGAGAA pLKO.1 1428 CDS 100% 4.950 2.475 Y MIA2 n/a
24 TRCN0000161860 GCCAAAGATCTTGAAGAAGAA pLKO.1 1378 CDS 100% 4.950 2.475 Y CTAGE4 n/a
25 TRCN0000005402 GCTATGAAGTAGAGTCATCTT pLKO.1 389 CDS 100% 4.950 2.475 Y CTAGE1 n/a
26 TRCN0000164371 CAAGATGAATTGATGGCGGAT pLKO.1 559 CDS 100% 2.160 1.080 Y CTAGE15 n/a
27 TRCN0000174282 CAGTTTAAGTAACTGCTGTTA pLKO.1 2537 3UTR 100% 0.495 0.248 Y n/a
28 TRCN0000148442 CCAGGACAATCATATCCTGAT pLKO.1 1903 CDS 100% 0.405 0.203 Y CTAGE6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005930.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10967 pDONR223 100% 99.2% 98.8% None (many diffs) n/a
2 ccsbBroad304_10967 pLX_304 0% 99.2% 98.8% V5 (many diffs) n/a
3 TRCN0000470328 CTTGCATGAATTTATTTTATTCTT pLX_317 13.8% 99.2% 98.8% V5 (many diffs) n/a
4 ccsbBroadEn_13076 pDONR223 100% 91.9% 86.2% None (many diffs) n/a
5 ccsbBroad304_13076 pLX_304 0% 91.9% 86.2% V5 (many diffs) n/a
6 TRCN0000481377 AACTAGAGAATGGGATCGGTCGAA pLX_317 19.7% 91.9% 86.2% V5 (many diffs) n/a
7 ccsbBroadEn_10968 pDONR223 100% 89.4% 89.4% None 1_240del;383_384insGGTAGAAAATCAAAT n/a
8 ccsbBroad304_10968 pLX_304 0% 89.4% 89.4% V5 1_240del;383_384insGGTAGAAAATCAAAT n/a
9 TRCN0000475416 ATAGTTAGCGCAGAAAAGATACGG pLX_317 11.5% 89.4% 89.4% V5 1_240del;383_384insGGTAGAAAATCAAAT n/a
10 ccsbBroadEn_03960 pDONR223 100% 86.9% 82% None (many diffs) n/a
11 ccsbBroad304_03960 pLX_304 0% 86.9% 82% V5 (many diffs) n/a
12 TRCN0000469836 CGAATATCTAATGCTCGTTTGACG pLX_317 17.1% 86.9% 82% V5 (many diffs) n/a
13 ccsbBroadEn_13596 pDONR223 100% 83.3% 74.5% None (many diffs) n/a
14 ccsbBroad304_13596 pLX_304 0% 83.3% 74.5% V5 (many diffs) n/a
Download CSV