Transcript: Human NM_006207.2

Homo sapiens platelet derived growth factor receptor like (PDGFRL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PDGFRL (5157)
Length:
1923
CDS:
446..1573

Additional Resources:

NCBI RefSeq record:
NM_006207.2
NBCI Gene record:
PDGFRL (5157)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000584060 GCGTATCTGGACACCTTTAAG pLKO_005 764 CDS 100% 13.200 18.480 N PDGFRL n/a
2 TRCN0000038691 CCAGGAGAGAATAGAATCAAA pLKO.1 542 CDS 100% 5.625 3.938 N PDGFRL n/a
3 TRCN0000298916 CCAGGAGAGAATAGAATCAAA pLKO_005 542 CDS 100% 5.625 3.938 N PDGFRL n/a
4 TRCN0000038689 GCTTCTTCAAACAAAGTGAAA pLKO.1 1277 CDS 100% 4.950 3.465 N PDGFRL n/a
5 TRCN0000298917 GCTTCTTCAAACAAAGTGAAA pLKO_005 1277 CDS 100% 4.950 3.465 N PDGFRL n/a
6 TRCN0000038692 GCCAATGGAACGGACATTGTT pLKO.1 1097 CDS 100% 0.563 0.394 N PDGFRL n/a
7 TRCN0000298843 GCCAATGGAACGGACATTGTT pLKO_005 1097 CDS 100% 0.563 0.394 N PDGFRL n/a
8 TRCN0000038690 CGATGTAAAGGGAGTAGAATT pLKO.1 728 CDS 100% 0.000 0.000 N PDGFRL n/a
9 TRCN0000298844 CGATGTAAAGGGAGTAGAATT pLKO_005 728 CDS 100% 0.000 0.000 N PDGFRL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06706 pDONR223 100% 99.9% 100% None 1041T>C n/a
2 ccsbBroad304_06706 pLX_304 0% 99.9% 100% V5 1041T>C n/a
3 TRCN0000481574 ACTGCAGCTACAGCAGGAGCACAA pLX_317 40.7% 99.9% 100% V5 1041T>C n/a
4 ccsbBroadEn_14735 pDONR223 0% 99.9% 100% None 1041T>C n/a
5 ccsbBroad304_14735 pLX_304 0% 99.9% 100% V5 1041T>C n/a
6 TRCN0000475233 GTCACCCACCACTCCTAAGATCAC pLX_317 42% 99.9% 100% V5 1041T>C n/a
7 TRCN0000488856 TTCTAATTCATGAGCTCAAAGTGG pLX_317 28.5% 99.9% 100% V5 (not translated due to prior stop codon) 1041T>C n/a
8 TRCN0000488180 CATTGTGGTCATTCTCCTCATTTA pLX_317 26.5% 99.7% 99.7% V5 999C>T;1041T>C;1125_1126insG n/a
Download CSV