Transcript: Human NM_007314.4

Homo sapiens ABL proto-oncogene 2, non-receptor tyrosine kinase (ABL2), transcript variant b, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ABL2 (27)
Length:
12217
CDS:
281..3829

Additional Resources:

NCBI RefSeq record:
NM_007314.4
NBCI Gene record:
ABL2 (27)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146662 TGTACACCATCACTCCACAG pXPR_003 TGG 748 21% 5 1.0589 ABL2 ABL2 77180
2 BRDN0001146737 TATCGAATGGAACAGCCTGA pXPR_003 GGG 1520 43% 9 0.9258 ABL2 ABL2 77179
3 BRDN0001146627 GGTTCAACATCACAACCATA pXPR_003 GGG 240 7% 3 0.1285 ABL2 ABL2 77178
4 BRDN0001147016 AACCTCTGTAATGACGACGG pXPR_003 TGG 2192 62% 12 0.0932 ABL2 ABL2 77177
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007314.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230772 TACAGTGGGTGCACGATATAT pLKO_005 6394 3UTR 100% 15.000 21.000 N ABL2 n/a
2 TRCN0000218328 CTTCTTTACACCACGCTTAAT pLKO_005 2530 CDS 100% 13.200 18.480 N ABL2 n/a
3 TRCN0000002029 CCAGGCACTAAATGAGGCTAT pLKO.1 538 CDS 100% 4.050 5.670 N ABL2 n/a
4 TRCN0000218815 GACAAACCCTGTCCTTAATAA pLKO_005 3763 CDS 100% 15.000 12.000 N ABL2 n/a
5 TRCN0000002031 GCGAACAGATATTACCATGAA pLKO.1 1132 CDS 100% 4.950 3.960 N ABL2 n/a
6 TRCN0000002030 CCTCGTCATCTGTTGTTCCAT pLKO.1 1962 CDS 100% 3.000 2.400 N ABL2 n/a
7 TRCN0000195370 CCTATGGAATGTCACCATATC pLKO.1 1719 CDS 100% 1.080 0.864 N ABL2 n/a
8 TRCN0000230770 ATACATGCCATACGGGAATTT pLKO_005 1366 CDS 100% 13.200 9.240 N ABL2 n/a
9 TRCN0000195032 CCCTAAGGTTTATGAACTTAT pLKO.1 1813 CDS 100% 13.200 9.240 N ABL2 n/a
10 TRCN0000002033 CCCTCAAACTCGCAACAAATT pLKO.1 3661 CDS 100% 13.200 9.240 N ABL2 n/a
11 TRCN0000199920 GATGGGCTGGTGACAACATTA pLKO.1 1037 CDS 100% 13.200 9.240 N ABL2 n/a
12 TRCN0000230771 TCCCTCAAACTCGCAACAAAT pLKO_005 3660 CDS 100% 13.200 9.240 N ABL2 n/a
13 TRCN0000199548 CCACTGAGAGTGACCCTAATC pLKO.1 591 CDS 100% 10.800 7.560 N ABL2 n/a
14 TRCN0000002032 CGGTCAGTATGGAGAGGTTTA pLKO.1 1168 CDS 100% 10.800 7.560 N ABL2 n/a
15 TRCN0000199757 GTTCCATGACTCCAGCATTTC pLKO.1 1906 CDS 100% 10.800 7.560 N ABL2 n/a
16 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 9256 3UTR 100% 4.950 2.475 Y ERAP2 n/a
17 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 9935 3UTR 100% 4.050 2.025 Y P3H4 n/a
18 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 9935 3UTR 100% 4.050 2.025 Y ORAI2 n/a
19 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 9935 3UTR 100% 4.050 2.025 Y P3H4 n/a
20 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 9311 3UTR 100% 4.050 2.025 Y LOC441087 n/a
21 TRCN0000023348 GATGCCAAAGAGACATGCTTT pLKO.1 2192 CDS 100% 4.950 3.465 N Abl2 n/a
22 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 9257 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007314.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489907 GGCAATTTCACTGAGGTCCCTCAT pLX_317 11.6% 97.1% 95.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14526 pDONR223 0% 94.5% 94.1% None (many diffs) n/a
3 ccsbBroad304_14526 pLX_304 0% 94.5% 94.1% V5 (many diffs) n/a
4 TRCN0000471114 CACTAGGCCAACTGCGTGAGATAA pLX_317 10.1% 94.5% 94.1% V5 (many diffs) n/a
Download CSV