Transcript: Mouse NM_007392.3

Mus musculus actin, alpha 2, smooth muscle, aorta (Acta2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Acta2 (11475)
Length:
2572
CDS:
108..1241

Additional Resources:

NCBI RefSeq record:
NM_007392.3
NBCI Gene record:
Acta2 (11475)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007392.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091664 GCATCCACGAAACCACCTATA pLKO.1 931 CDS 100% 10.800 15.120 N Acta2 n/a
2 TRCN0000091665 CTGACGCTGAAGTATCCGATA pLKO.1 306 CDS 100% 4.050 5.670 N Acta2 n/a
3 TRCN0000091666 CACTCTTTCTATAACGAGCTT pLKO.1 375 CDS 100% 2.640 3.696 N Acta2 n/a
4 TRCN0000429088 GTGACTCACAACGTGCCTATC pLKO_005 588 CDS 100% 6.000 4.800 N Acta2 n/a
5 TRCN0000091663 GCCTAGCAACACTGATTCAAT pLKO.1 1399 3UTR 100% 5.625 4.500 N Acta2 n/a
6 TRCN0000413566 AGAGCGTATAGGACTTGTATA pLKO_005 1578 3UTR 100% 13.200 9.240 N Acta2 n/a
7 TRCN0000430144 TCTGTTAGGTGAGAATCATTT pLKO_005 1426 3UTR 100% 13.200 9.240 N Acta2 n/a
8 TRCN0000091667 TCAGGGAGTAATGGTTGGAAT pLKO.1 233 CDS 100% 4.950 3.465 N Acta2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007392.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00014 pDONR223 100% 91.4% 100% None (many diffs) n/a
2 ccsbBroad304_00014 pLX_304 0% 91.4% 100% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000467679 GCTACTGCTTTGAGGGTTATAACT pLX_317 37.9% 91.4% 100% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_00015 pDONR223 100% 84% 98.4% None (many diffs) n/a
5 ccsbBroad304_00015 pLX_304 0% 84% 98.4% V5 (many diffs) n/a
6 TRCN0000468012 TCTATATTCTTCCCTCACTCATAA pLX_317 37.9% 84% 98.4% V5 (many diffs) n/a
7 ccsbBroadEn_05763 pDONR223 100% 82.3% 93.1% None (many diffs) n/a
8 ccsbBroad304_05763 pLX_304 53.1% 82.3% 93.1% V5 (many diffs) n/a
9 TRCN0000470279 TCAAGCCTGGAACGGGCTCACGTC pLX_317 31.7% 82.3% 93.1% V5 (many diffs) n/a
10 ccsbBroadEn_05764 pDONR223 100% 81.8% 93.6% None (many diffs) n/a
11 ccsbBroad304_05764 pLX_304 0% 81.8% 93.6% V5 (many diffs) n/a
12 TRCN0000466781 AATTGTGGTGCTTGTTGCCGCCTG pLX_317 31.7% 81.8% 93.6% V5 (many diffs) n/a
13 ccsbBroadEn_15351 pDONR223 0% 81.7% 93.6% None (many diffs) n/a
14 ccsbBroad304_15351 pLX_304 0% 81.7% 93.6% V5 (many diffs) n/a
15 ccsbBroadEn_13808 pDONR223 100% 81.7% 93.1% None (many diffs) n/a
16 ccsbBroad304_13808 pLX_304 0% 81.7% 93.1% V5 (not translated due to frame shift) (many diffs) n/a
17 TRCN0000471742 AATGGGAGTTCTCACGTCAGGTCC pLX_317 44.8% 81.7% 93.1% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV