Transcript: Mouse NM_009610.2

Mus musculus actin, gamma 2, smooth muscle, enteric (Actg2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Actg2 (11468)
Length:
1341
CDS:
109..1239

Additional Resources:

NCBI RefSeq record:
NM_009610.2
NBCI Gene record:
Actg2 (11468)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009610.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090535 AGAAATTGTACGAGACATCAA pLKO.1 729 CDS 100% 4.950 6.930 N Actg2 n/a
2 TRCN0000090534 CTAACTCTCAAGTACCCTATT pLKO.1 304 CDS 100% 10.800 7.560 N Actg2 n/a
3 TRCN0000335239 CTAACTCTCAAGTACCCTATT pLKO_005 304 CDS 100% 10.800 7.560 N Actg2 n/a
4 TRCN0000090533 CCGCAAAGATTTGTATGCTAA pLKO.1 978 CDS 100% 4.950 3.465 N Actg2 n/a
5 TRCN0000335304 CCGCAAAGATTTGTATGCTAA pLKO_005 978 CDS 100% 4.950 3.465 N Actg2 n/a
6 TRCN0000090537 GCTGAGAGAGAAATTGTACGA pLKO.1 721 CDS 100% 2.640 1.848 N Actg2 n/a
7 TRCN0000335241 GCTGAGAGAGAAATTGTACGA pLKO_005 721 CDS 100% 2.640 1.848 N Actg2 n/a
8 TRCN0000090536 CCTGCCATGTATGTTGCTATT pLKO.1 499 CDS 100% 10.800 6.480 N Actg2 n/a
9 TRCN0000335302 CCTGCCATGTATGTTGCTATT pLKO_005 499 CDS 100% 10.800 6.480 N Actg2 n/a
10 TRCN0000117346 CATCACCAACTGGGATGACAT pLKO.1 336 CDS 100% 4.950 2.970 N ACTA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009610.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05765 pDONR223 100% 92.7% None (many diffs) n/a
2 ccsbBroad304_05765 pLX_304 0% 92.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479785 GTCCCCTGGATCAGGACGGTAAAA pLX_317 31.6% 92.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_00015 pDONR223 100% 85.6% 98.6% None (many diffs) n/a
5 ccsbBroad304_00015 pLX_304 0% 85.6% 98.6% V5 (many diffs) n/a
6 TRCN0000468012 TCTATATTCTTCCCTCACTCATAA pLX_317 37.9% 85.6% 98.6% V5 (many diffs) n/a
7 ccsbBroadEn_00014 pDONR223 100% 84.7% 99.2% None (many diffs) n/a
8 ccsbBroad304_00014 pLX_304 0% 84.7% 99.2% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000467679 GCTACTGCTTTGAGGGTTATAACT pLX_317 37.9% 84.7% 99.2% V5 (not translated due to prior stop codon) (many diffs) n/a
10 ccsbBroadEn_05763 pDONR223 100% 83% 92.8% None (many diffs) n/a
11 ccsbBroad304_05763 pLX_304 53.1% 83% 92.8% V5 (many diffs) n/a
12 TRCN0000470279 TCAAGCCTGGAACGGGCTCACGTC pLX_317 31.7% 83% 92.8% V5 (many diffs) n/a
13 ccsbBroadEn_05764 pDONR223 100% 81.7% 93.8% None (many diffs) n/a
14 ccsbBroad304_05764 pLX_304 0% 81.7% 93.8% V5 (many diffs) n/a
15 TRCN0000466781 AATTGTGGTGCTTGTTGCCGCCTG pLX_317 31.7% 81.7% 93.8% V5 (many diffs) n/a
16 ccsbBroadEn_15351 pDONR223 0% 81.6% 93.8% None (many diffs) n/a
17 ccsbBroad304_15351 pLX_304 0% 81.6% 93.8% V5 (many diffs) n/a
18 ccsbBroadEn_13808 pDONR223 100% 81.6% 93.3% None (many diffs) n/a
19 ccsbBroad304_13808 pLX_304 0% 81.6% 93.3% V5 (not translated due to frame shift) (many diffs) n/a
20 TRCN0000471742 AATGGGAGTTCTCACGTCAGGTCC pLX_317 44.8% 81.6% 93.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV