Transcript: Human NM_018925.2

Homo sapiens protocadherin gamma subfamily B, 5 (PCDHGB5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PCDHGB5 (56101)
Length:
4578
CDS:
1..2772

Additional Resources:

NCBI RefSeq record:
NM_018925.2
NBCI Gene record:
PCDHGB5 (56101)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056328 GCGGAGAAATTACCACTCAAA pLKO.1 881 CDS 100% 4.950 6.930 N PCDHGB5 n/a
2 TRCN0000056329 GCGTCCTACTTAGTCAGTGTA pLKO.1 1351 CDS 100% 4.950 6.930 N PCDHGB5 n/a
3 TRCN0000365221 CATAAGCGTCATCCTACATAT pLKO_005 1293 CDS 100% 13.200 9.240 N PCDHGB5 n/a
4 TRCN0000365280 GAGAAACAGGATGGTAGTAAA pLKO_005 550 CDS 100% 13.200 9.240 N PCDHGB5 n/a
5 TRCN0000365222 GGTAACCGACGCCAATGATAA pLKO_005 693 CDS 100% 13.200 9.240 N PCDHGB5 n/a
6 TRCN0000377575 TAGCAGAAGATGCAGATATTG pLKO_005 467 CDS 100% 13.200 9.240 N PCDHGB5 n/a
7 TRCN0000056330 CGGGCAAATCTTTAGTCTGAA pLKO.1 852 CDS 100% 4.950 3.465 N PCDHGB5 n/a
8 TRCN0000056332 GCCTGGAACACTAATTGCTTT pLKO.1 1071 CDS 100% 4.950 3.465 N PCDHGB5 n/a
9 TRCN0000056331 CGGGAACAACAGAGTTACCAT pLKO.1 604 CDS 100% 3.000 2.100 N PCDHGB5 n/a
10 TRCN0000365219 TAACCCAAGTTTCTCATTAAT pLKO_005 522 CDS 100% 15.000 9.000 N PCDHGB5 n/a
11 TRCN0000370408 TGAAGAGACCAAGGAATATTC pLKO_005 915 CDS 100% 13.200 7.920 N PCDHGB5 n/a
12 TRCN0000370350 TGCACAATGTACAGTTGAAAT pLKO_005 972 CDS 100% 13.200 7.920 N PCDHGB5 n/a
13 TRCN0000053813 CCAGCCATAAACCAATAACTA pLKO.1 3673 3UTR 100% 5.625 2.813 Y PCDHGA2 n/a
14 TRCN0000203363 CCCAAGATCAATGCTCAAGTT pLKO.1 3318 3UTR 100% 4.950 2.475 Y PCDHGA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03699 pDONR223 100% 86.1% 86% None (many diffs) n/a
2 ccsbBroad304_03699 pLX_304 0% 86.1% 86% V5 (many diffs) n/a
3 TRCN0000479860 AAACGTTTACTGGGAGATGGATTC pLX_317 13.4% 86.1% 86% V5 (many diffs) n/a
4 ccsbBroadEn_01978 pDONR223 100% 73.1% 72.2% None (many diffs) n/a
5 ccsbBroad304_01978 pLX_304 0% 73.1% 72.2% V5 (many diffs) n/a
6 TRCN0000478221 GCCCACTCGCTACGATAAATGTGG pLX_317 10.5% 73.1% 72.2% V5 (many diffs) n/a
7 ccsbBroadEn_01151 pDONR223 100% 14.2% 13.6% None (many diffs) n/a
8 ccsbBroad304_01151 pLX_304 0% 14.2% 13.6% V5 (many diffs) n/a
9 TRCN0000466539 CATGGTTCGGTAATGAAAGTTCCA pLX_317 36.4% 14.2% 13.6% V5 (many diffs) n/a
10 ccsbBroadEn_11019 pDONR223 100% 6.5% 6.5% None 1_2589del n/a
11 ccsbBroad304_11019 pLX_304 0% 6.5% 6.5% V5 1_2589del n/a
Download CSV