Transcript: Human NM_019078.1

Homo sapiens UDP glucuronosyltransferase family 1 member A5 (UGT1A5), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
UGT1A5 (54579)
Length:
2345
CDS:
1..1605

Additional Resources:

NCBI RefSeq record:
NM_019078.1
NBCI Gene record:
UGT1A5 (54579)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034575 CTTTGATCATACATAGGTCTT pLKO.1 362 CDS 100% 4.050 3.240 N UGT1A5 n/a
2 TRCN0000034578 CACACTCAATCGTTCTTTGAA pLKO.1 286 CDS 100% 5.625 3.938 N UGT1A5 n/a
3 TRCN0000034574 AGGACGAATTTGATCGCCTTT pLKO.1 257 CDS 100% 4.050 2.835 N UGT1A5 n/a
4 TRCN0000034576 CCATGCTGTTTCTGCTCCTTA pLKO.1 672 CDS 100% 4.950 2.970 N UGT1A5 n/a
5 TRCN0000034577 CCTAGATTACTAACGACCAAT pLKO.1 583 CDS 100% 4.950 2.970 N UGT1A5 n/a
6 TRCN0000429851 AGTGGCCTTCATCACCTTTAA pLKO_005 1506 CDS 100% 13.200 6.600 Y UGT1A6 n/a
7 TRCN0000433060 GGAATTTGAAGCCTACATTAA pLKO_005 867 CDS 100% 13.200 6.600 Y UGT1A8 n/a
8 TRCN0000365387 TGAACCATTCCCTAGTCATTT pLKO_005 1634 3UTR 100% 13.200 6.600 Y UGT1A7 n/a
9 TRCN0000370492 ACCATTCCTTGGACGTGATTG pLKO_005 1460 CDS 100% 10.800 5.400 Y UGT1A7 n/a
10 TRCN0000432861 ATGGTTGCAATTGATCCTTAA pLKO_005 1996 3UTR 100% 10.800 5.400 Y UGT1A6 n/a
11 TRCN0000428119 GAGAAGAAAGCTATGGCAATT pLKO_005 949 CDS 100% 10.800 5.400 Y UGT1A6 n/a
12 TRCN0000443915 GCAAAGCGCATGGAGACTAAG pLKO_005 1204 CDS 100% 10.800 5.400 Y UGT1A6 n/a
13 TRCN0000370426 GTGCTTATGGCTACCGGAAAT pLKO_005 1532 CDS 100% 10.800 5.400 Y UGT1A7 n/a
14 TRCN0000414229 GTGGGTGGGAAATAAGGTAAA pLKO_005 1609 3UTR 100% 10.800 5.400 Y UGT1A8 n/a
15 TRCN0000445577 TTGGGAGTGCGGGATTCAAAG pLKO_005 1913 3UTR 100% 10.800 5.400 Y UGT1A6 n/a
16 TRCN0000429759 ATGACTTCTGAAGATTTAGAA pLKO_005 1255 CDS 100% 5.625 2.813 Y UGT1A6 n/a
17 TRCN0000034617 CCACTATCTCAGGAATTTGAA pLKO.1 856 CDS 100% 5.625 2.813 Y UGT1A3 n/a
18 TRCN0000441648 GCTGGAGTGACCCTGAATGTT pLKO_005 1228 CDS 100% 5.625 2.813 Y UGT1A6 n/a
19 TRCN0000418714 AGTTACAAGGAGAACATCATG pLKO_005 1306 CDS 100% 4.950 2.475 Y UGT1A6 n/a
20 TRCN0000036407 CACCTTTAAATGTTGTGCTTA pLKO.1 1518 CDS 100% 4.950 2.475 Y UGT1A10 n/a
21 TRCN0000034773 CATGGTGTTTATGAAAGCATA pLKO.1 1129 CDS 100% 4.950 2.475 Y UGT1A6 n/a
22 TRCN0000029531 CGAGTTAAGAAAGCCCACAAA pLKO.1 1570 CDS 100% 4.950 2.475 Y UGT1A1 n/a
23 TRCN0000436928 ATCTGCTTGGTCACCCGATGA pLKO_005 1079 CDS 100% 4.050 2.025 Y UGT1A6 n/a
24 TRCN0000034772 CCCACAAATCCAAGACCCATT pLKO.1 1583 CDS 100% 4.050 2.025 Y UGT1A6 n/a
25 TRCN0000034771 GCGAACAACACGATACTTGTT pLKO.1 1039 CDS 100% 0.495 0.248 Y UGT1A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08398 pDONR223 100% 96.3% 93.4% None (many diffs) n/a
2 ccsbBroad304_08398 pLX_304 0% 96.3% 93.4% V5 (many diffs) n/a
3 TRCN0000476276 CCCCGTCAAATAACTTGGATCGCT pLX_317 22.9% 96.3% 93.4% V5 (many diffs) n/a
4 ccsbBroadEn_12069 pDONR223 100% 79% 75% None (many diffs) n/a
5 TRCN0000476021 ATCCGATTTCGGTTTATTGGACAC pLX_317 26% 79% 75% V5 (many diffs) n/a
6 ccsbBroadEn_03445 pDONR223 100% 77.4% 73.1% None (many diffs) n/a
7 ccsbBroad304_03445 pLX_304 0% 77.4% 73.1% V5 (many diffs) n/a
8 TRCN0000476945 TGCCTACTTCTAATCTGCGATGCC pLX_317 28.2% 77.4% 73.1% V5 (many diffs) n/a
Download CSV