Transcript: Human NM_019591.4

Homo sapiens zinc finger protein 26 (ZNF26), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ZNF26 (7574)
Length:
17697
CDS:
475..2076

Additional Resources:

NCBI RefSeq record:
NM_019591.4
NBCI Gene record:
ZNF26 (7574)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019591.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014863 CGGATAATATAGACAGGATTT pLKO.1 2122 3UTR 100% 10.800 15.120 N ZNF26 n/a
2 TRCN0000229684 TACATCGGAAGACTCATAAAT pLKO_005 2054 CDS 100% 15.000 12.000 N ZNF26 n/a
3 TRCN0000218352 AGCTCCAAGCAGAAGTTATTT pLKO_005 891 CDS 100% 15.000 10.500 N ZNF26 n/a
4 TRCN0000229685 TACACTAGGAACACCTTATAA pLKO_005 2330 3UTR 100% 15.000 10.500 N ZNF26 n/a
5 TRCN0000218562 AGTGCCAAGTCAAACCTTAAT pLKO_005 1108 CDS 100% 13.200 9.240 N ZNF26 n/a
6 TRCN0000229683 TCAAGACAGAGACTCTATAAC pLKO_005 841 CDS 100% 13.200 9.240 N ZNF26 n/a
7 TRCN0000014864 CCTGATAAGTTTCATGGTTAT pLKO.1 922 CDS 100% 10.800 7.560 N ZNF26 n/a
8 TRCN0000014867 GAGAGTATTGAAAGAAGCTAT pLKO.1 772 CDS 100% 4.950 3.465 N ZNF26 n/a
9 TRCN0000014865 GCTACTGGATTCTACACAGAA pLKO.1 561 CDS 100% 4.950 3.465 N ZNF26 n/a
10 TRCN0000014866 GAGAACTCATTCAACTGAGAA pLKO.1 1809 CDS 100% 4.950 2.970 N ZNF26 n/a
11 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 6922 3UTR 100% 10.800 5.400 Y MRPS16 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5688 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 12590 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 12590 3UTR 100% 4.050 2.025 Y ORAI2 n/a
15 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 12590 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5689 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 6922 3UTR 100% 10.800 5.400 Y CD3EAP n/a
18 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 12265 3UTR 100% 10.800 5.400 Y SMIM11A n/a
19 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 12003 3UTR 100% 5.625 2.813 Y KLHL30 n/a
20 TRCN0000012945 GCAGTGAATGTGGGAAAGCTT pLKO.1 1253 CDS 100% 3.000 1.500 Y ZNF146 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 12003 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019591.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07155 pDONR223 100% 99.8% 100% None 1119T>C;1515C>T n/a
2 ccsbBroad304_07155 pLX_304 0% 99.8% 100% V5 1119T>C;1515C>T n/a
3 TRCN0000467465 AACCAGTGTGTGTGTCATCAAACA pLX_317 27.4% 99.8% 100% V5 1119T>C;1515C>T n/a
4 ccsbBroadEn_11229 pDONR223 100% 37.3% 37.3% None 1_1002del n/a
5 ccsbBroad304_11229 pLX_304 0% 37.3% 37.3% V5 1_1002del n/a
6 TRCN0000474811 TGAAGACCGTAAGGCGGCAATTTC pLX_317 80.5% 37.3% 37.3% V5 1_1002del n/a
Download CSV