Transcript: Human NM_021155.4

Homo sapiens CD209 molecule (CD209), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CD209 (30835)
Length:
4284
CDS:
24..1238

Additional Resources:

NCBI RefSeq record:
NM_021155.4
NBCI Gene record:
CD209 (30835)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021155.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371754 ACTGGTTGCAAGAGCTCATTT pLKO_005 1622 3UTR 100% 13.200 9.240 N CD209 n/a
2 TRCN0000371752 GGACTGTTCTTTGTCAGATTC pLKO_005 1305 3UTR 100% 10.800 7.560 N CD209 n/a
3 TRCN0000029690 GCTTCCAGAGAAATCTAAGAT pLKO.1 500 CDS 100% 5.625 3.938 N CD209 n/a
4 TRCN0000371753 ATCCAGGCAAGACGCGATCTA pLKO_005 236 CDS 100% 4.950 3.465 N CD209 n/a
5 TRCN0000029692 CGAGGATACAAGAGCTTAGCA pLKO.1 108 CDS 100% 3.000 2.100 N CD209 n/a
6 TRCN0000029689 CGACAAATGTAATCTTGCCAA pLKO.1 1121 CDS 100% 2.640 1.848 N CD209 n/a
7 TRCN0000029693 GCAGTATTGGAACAGAGGAGA pLKO.1 1043 CDS 100% 2.640 1.848 N CD209 n/a
8 TRCN0000198881 GCATTCTTCTTCCGACTGGTA pLKO.1 2665 3UTR 100% 2.640 1.848 N Commd1 n/a
9 TRCN0000029691 TCCAGGGATGAAGAACAGTTT pLKO.1 1176 CDS 100% 4.950 2.970 N CD209 n/a
10 TRCN0000063698 GCCCAGCTAATTCTTGTATTT pLKO.1 2947 3UTR 100% 13.200 6.600 Y RASA4 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3045 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3045 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021155.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11921 pDONR223 100% 90.4% 89.5% None (many diffs) n/a
2 ccsbBroad304_11921 pLX_304 0% 90.4% 89.5% V5 (many diffs) n/a
3 TRCN0000470842 CGGCAAAATAGCGCGGCTCGTATT pLX_317 13.1% 90.4% 89.5% V5 (many diffs) n/a
4 ccsbBroadEn_11484 pDONR223 100% 89.4% 86.6% None (many diffs) n/a
5 ccsbBroad304_11484 pLX_304 0% 89.4% 86.6% V5 (many diffs) n/a
6 TRCN0000473292 TGCTTACACTGCGATGGTTGTTCT pLX_317 27.2% 89.4% 86.6% V5 (many diffs) n/a
7 ccsbBroadEn_07589 pDONR223 100% 84.2% 79.3% None (many diffs) n/a
8 ccsbBroad304_07589 pLX_304 0% 84.2% 79.3% V5 (many diffs) n/a
9 TRCN0000470248 GGGCCATAAGAAATATCGCACTAC pLX_317 43.3% 84.2% 79.3% V5 (many diffs) n/a
Download CSV