Transcript: Human NM_022146.5

Homo sapiens neuropeptide FF receptor 1 (NPFFR1), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
NPFFR1 (64106)
Length:
9249
CDS:
329..1621

Additional Resources:

NCBI RefSeq record:
NM_022146.5
NBCI Gene record:
NPFFR1 (64106)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022146.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245268 ACGGCTACTTCAACGAGAACT pLKO_005 1314 CDS 100% 4.950 3.960 N Npffr1 n/a
2 TRCN0000363202 ACGGCTACTTCAACGAGAACT pLKO_005 1314 CDS 100% 4.950 3.960 N NPFFR1 n/a
3 TRCN0000009454 GCATACTGTCACCAACATGTT pLKO.1 550 CDS 100% 4.950 3.960 N NPFFR1 n/a
4 TRCN0000363132 CTAAGTCAGAATGGGACTAAC pLKO_005 371 CDS 100% 10.800 7.560 N NPFFR1 n/a
5 TRCN0000009453 CCTAAGTCAGAATGGGACTAA pLKO.1 370 CDS 100% 4.950 3.465 N NPFFR1 n/a
6 TRCN0000009456 CCTCACCTTCTCCTCCTACTA pLKO.1 415 CDS 100% 4.950 3.465 N NPFFR1 n/a
7 TRCN0000009452 CGGCTACTTCAACGAGAACTT pLKO.1 1315 CDS 100% 4.950 3.465 N NPFFR1 n/a
8 TRCN0000009455 CTTCGACAATGCCACATGCAA pLKO.1 658 CDS 100% 3.000 2.100 N NPFFR1 n/a
9 TRCN0000357881 TCACCTTCTCCTCCTACTATC pLKO_005 417 CDS 100% 10.800 6.480 N NPFFR1 n/a
10 TRCN0000357882 TTGTGGCCTATGCGCTCATCT pLKO_005 468 CDS 100% 4.950 2.970 N NPFFR1 n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 6815 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 6815 3UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 7851 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 7851 3UTR 100% 4.050 2.025 Y ORAI2 n/a
15 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 7851 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7813 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7419 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 6813 3UTR 100% 4.950 2.475 Y ERN2 n/a
19 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 6813 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 6813 3UTR 100% 4.950 2.475 Y P3H4 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7419 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022146.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08834 pDONR223 100% 99.9% 100% None 597G>T n/a
2 ccsbBroad304_08834 pLX_304 0% 99.9% 100% V5 597G>T n/a
3 TRCN0000476275 TTGTCACTTTTATACGGGTAGATG pLX_317 26.5% 99.9% 100% V5 597G>T n/a
4 TRCN0000489011 CTAATCTTTTGTAGGGGAGGGGGT pLX_317 16.7% 99.9% 100% V5 597G>T n/a
5 TRCN0000487701 CCGTGAGCCAAGAATTGAAACCCC pLX_317 18.4% 99.9% 100% V5 (not translated due to prior stop codon) 597G>T n/a
Download CSV