Transcript: Human NM_022756.6

Homo sapiens MYST/Esa1 associated factor 6 (MEAF6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
MEAF6 (64769)
Length:
4765
CDS:
21..626

Additional Resources:

NCBI RefSeq record:
NM_022756.6
NBCI Gene record:
MEAF6 (64769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022756.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276491 GGCGGAAACATTGGCAAATTT pLKO_005 107 CDS 100% 15.000 21.000 N MEAF6 n/a
2 TRCN0000131146 GTTCAGGACCAGCTCATTGAA pLKO.1 336 CDS 100% 5.625 7.875 N MEAF6 n/a
3 TRCN0000276492 GTTCAGGACCAGCTCATTGAA pLKO_005 336 CDS 100% 5.625 7.875 N MEAF6 n/a
4 TRCN0000176434 CAGACTTCCACAATCAGGAAA pLKO.1 397 CDS 100% 4.950 6.930 N Meaf6 n/a
5 TRCN0000128122 CTCTTCAGTAAATCCTCGGTT pLKO.1 282 CDS 100% 2.640 3.696 N MEAF6 n/a
6 TRCN0000276439 CTCAGATGTATGGCAATATTA pLKO_005 172 CDS 100% 15.000 10.500 N MEAF6 n/a
7 TRCN0000276440 AGTAGAACACAAGTCACATTT pLKO_005 998 3UTR 100% 13.200 9.240 N MEAF6 n/a
8 TRCN0000130900 GCTGAGGAATCTGCTAGTAAT pLKO.1 1681 3UTR 100% 13.200 9.240 N MEAF6 n/a
9 TRCN0000175318 CTGGAAGACACTCAGATGTAT pLKO.1 162 CDS 100% 5.625 3.938 N Meaf6 n/a
10 TRCN0000131218 GATCGAAGGAACCGGAAGTTT pLKO.1 246 CDS 100% 5.625 3.938 N MEAF6 n/a
11 TRCN0000285577 GATCGAAGGAACCGGAAGTTT pLKO_005 246 CDS 100% 5.625 3.938 N MEAF6 n/a
12 TRCN0000127694 GCCTGTGACTTTGAGTAGTTT pLKO.1 748 3UTR 100% 5.625 3.938 N MEAF6 n/a
13 TRCN0000173690 CCTGGAAGACACTCAGATGTA pLKO.1 161 CDS 100% 4.950 3.465 N Meaf6 n/a
14 TRCN0000129565 GTAAGTGCATTGGCAGGAGTT pLKO.1 318 CDS 100% 4.050 2.835 N MEAF6 n/a
15 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 3935 3UTR 100% 10.800 5.400 Y MRPS16 n/a
16 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2417 3UTR 100% 4.950 2.475 Y CFLAR n/a
17 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2417 3UTR 100% 4.950 2.475 Y C19orf31 n/a
18 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 3935 3UTR 100% 10.800 5.400 Y CD3EAP n/a
19 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3460 3UTR 100% 5.625 2.813 Y KLHL30 n/a
20 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2415 3UTR 100% 4.950 2.475 Y ERN2 n/a
21 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2415 3UTR 100% 4.950 2.475 Y P3H4 n/a
22 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2415 3UTR 100% 4.950 2.475 Y P3H4 n/a
23 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 3699 3UTR 100% 0.495 0.248 Y C11orf44 n/a
24 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3460 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022756.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12486 pDONR223 100% 95% 94.5% None 534_563del n/a
2 ccsbBroad304_12486 pLX_304 0% 95% 94.5% V5 534_563del n/a
3 TRCN0000472742 TCCCCAACCTCATGACTCCCGACG pLX_317 92% 95% 94.5% V5 534_563del n/a
Download CSV