Transcript: Human NM_145112.3

Homo sapiens MYC associated factor X (MAX), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MAX (4149)
Length:
1983
CDS:
179..634

Additional Resources:

NCBI RefSeq record:
NM_145112.3
NBCI Gene record:
MAX (4149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145112.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231551 CTGAGTGAATTGTACCTATTT pLKO_005 1491 3UTR 100% 13.200 18.480 N MAX n/a
2 TRCN0000039863 CCCGTGTGTATTTCTAAGAAA pLKO.1 1574 3UTR 100% 5.625 7.875 N MAX n/a
3 TRCN0000304477 ACGTAGGGACCACATCAAAGA pLKO_005 253 CDS 100% 4.950 6.930 N Max n/a
4 TRCN0000010375 ACGTAGAAGCTCTTGGACAAC pLKO.1 777 3UTR 100% 4.050 5.670 N MAX n/a
5 TRCN0000039866 GCAAGATATTGACGACCTCAA pLKO.1 397 CDS 100% 4.050 5.670 N MAX n/a
6 TRCN0000231550 ACACACACCAGCAAGATATTG pLKO_005 387 CDS 100% 13.200 9.240 N MAX n/a
7 TRCN0000039864 CCACAGAATATATCCAGTATA pLKO.1 351 CDS 100% 13.200 9.240 N MAX n/a
8 TRCN0000231549 CCACAGAATATATCCAGTATA pLKO_005 351 CDS 100% 13.200 9.240 N MAX n/a
9 TRCN0000231548 GACAAACGGGCTCATCATAAT pLKO_005 218 CDS 100% 13.200 9.240 N MAX n/a
10 TRCN0000039867 GACCACATCAAAGACAGCTTT pLKO.1 260 CDS 100% 4.950 3.465 N MAX n/a
11 TRCN0000374209 TGCCCAACTGCAGACCAACTA pLKO_005 475 CDS 100% 4.950 3.465 N Max n/a
12 TRCN0000010374 CATCATAATGCACTGGAACGA pLKO.1 230 CDS 100% 2.640 1.848 N MAX n/a
13 TRCN0000039865 GCTCATCATAATGCACTGGAA pLKO.1 227 CDS 100% 2.640 1.848 N MAX n/a
14 TRCN0000010376 TGTGAATCTGAACTGCTCTAC pLKO.1 1060 3UTR 100% 4.050 2.430 N MAX n/a
15 TRCN0000042715 CCCAAATCCTAGACAAAGCAA pLKO.1 333 CDS 100% 3.000 4.200 N Max n/a
16 TRCN0000316020 CCCAAATCCTAGACAAAGCAA pLKO_005 333 CDS 100% 3.000 4.200 N Max n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145112.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15495 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15495 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468720 GTCTTCCACGTTCCTTTAATGCAG pLX_317 73.3% 100% 100% V5 n/a
4 ccsbBroadEn_15494 pDONR223 0% 99.7% 99.3% None 382G>T n/a
5 ccsbBroad304_15494 pLX_304 0% 99.7% 99.3% V5 382G>T n/a
6 TRCN0000469052 TCAGTACTAGGAAGGTCTCTACGA pLX_317 74.2% 99.7% 99.3% V5 382G>T n/a
7 ccsbBroadEn_00978 pDONR223 100% 94.3% 94.3% None 36_37ins27 n/a
8 ccsbBroad304_00978 pLX_304 0% 94.3% 94.3% V5 36_37ins27 n/a
9 TRCN0000467427 CCTTCTTCGGGGACGGAAGTTACA pLX_317 69.4% 94.3% 94.3% V5 36_37ins27 n/a
10 ccsbBroadEn_06564 pDONR223 100% 71.2% 51% None (many diffs) n/a
11 ccsbBroad304_06564 pLX_304 0% 71.2% 51% V5 (many diffs) n/a
12 TRCN0000473082 TAAATTTTGTCTGCTATTGACACA pLX_317 100% 71.2% 51% V5 (many diffs) n/a
13 ccsbBroadEn_00977 pDONR223 100% 40.7% 32.5% None (many diffs) n/a
14 ccsbBroad304_00977 pLX_304 0% 40.7% 32.5% V5 (many diffs) n/a
15 TRCN0000471511 CTCATGCCCAAAAATTGGGTAACG pLX_317 100% 40.7% 32.5% V5 (many diffs) n/a
Download CSV