Transcript: Human NM_175729.1

Homo sapiens SSX family member 4 (SSX4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
SSX4 (6759)
Length:
1114
CDS:
59..520

Additional Resources:

NCBI RefSeq record:
NM_175729.1
NBCI Gene record:
SSX4 (6759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021762 CCAGGGATGATGCTCAAATAT pLKO.1 90 CDS 100% 15.000 7.500 Y SSX4 n/a
2 TRCN0000180091 CCCAGGGATGATGCTCAAATA pLKO.1 89 CDS 100% 13.200 6.600 Y SSX4B n/a
3 TRCN0000115723 CTTCGATGATATTGCCAAATA pLKO.1 130 CDS 100% 13.200 6.600 Y SSX9P n/a
4 TRCN0000020146 CCTTCGATGATATTGCCAAAT pLKO.1 129 CDS 100% 10.800 5.400 Y SSX3 n/a
5 TRCN0000413186 TGAGTGTTTAATTTCCGATTT pLKO_005 863 3UTR 100% 10.800 5.400 Y SSX7 n/a
6 TRCN0000021761 CCCACCTTTCATGCGTAGTAA pLKO.1 259 CDS 100% 5.625 2.813 Y SSX4 n/a
7 TRCN0000021760 GCCAAATACTTCTCTAAGAAA pLKO.1 143 CDS 100% 5.625 2.813 Y SSX4 n/a
8 TRCN0000021689 CCTGAGGAAGATGACGAGTAA pLKO.1 469 CDS 100% 4.950 2.475 Y SSX2 n/a
9 TRCN0000179583 GCTGGTGGTTTATGAAGAGAT pLKO.1 441 CDS 100% 4.950 2.475 Y SSX4B n/a
10 TRCN0000157537 GTGTGCCAAGAGTTCGATGTT pLKO.1 644 3UTR 100% 4.950 2.475 Y SSX5 n/a
11 TRCN0000121776 CTGAGTGTTTAATTTCCGATT pLKO.1 862 3UTR 100% 4.050 2.025 Y SSX6P n/a
12 TRCN0000021759 GAAGCTAAACTATGAGGTCAT pLKO.1 211 CDS 100% 4.050 2.025 Y SSX4 n/a
13 TRCN0000021692 GCCTTCGATGATATTGCCAAA pLKO.1 128 CDS 100% 4.050 2.025 Y SSX2 n/a
14 TRCN0000180998 GCTTGTGTATCCATGCACCTA pLKO.1 755 3UTR 100% 2.640 1.320 Y SSX4B n/a
15 TRCN0000115807 GCAAGTGTTCACAACAGTGAA pLKO.1 601 3UTR 100% 0.495 0.248 Y SSX6P n/a
16 TRCN0000152838 GCAAGTGTTCACAACAGTGAA pLKO.1 601 3UTR 100% 0.495 0.248 Y SSX5 n/a
17 TRCN0000115722 GCCCATGATGAGAAGCAGAAT pLKO.1 513 CDS 100% 4.950 2.475 Y SSX9P n/a
18 TRCN0000021763 CCAGAGAATCTTCCCGAAGAT pLKO.1 370 CDS 100% 0.495 0.248 Y SSX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11160 pDONR223 100% 93% 87% None (many diffs) n/a
2 ccsbBroad304_11160 pLX_304 0% 93% 87% V5 (many diffs) n/a
3 TRCN0000466761 AGTGCTGCACGATATCGTACACTG pLX_317 72.1% 93% 87% V5 (many diffs) n/a
4 ccsbBroadEn_07003 pDONR223 100% 71.9% 57% None 329_330ins136;429_459del n/a
5 ccsbBroad304_07003 pLX_304 0% 71.9% 57% V5 329_330ins136;429_459del n/a
6 TRCN0000475229 CCACCCTATAATTCAACTACCTAC pLX_317 62.8% 71.9% 57% V5 329_330ins136;429_459del n/a
7 TRCN0000487987 CTCGTAAATATTTCCCCCGTTCGT pLX_317 48.3% 65.7% 45.6% V5 (many diffs) n/a
8 TRCN0000487931 GACCATATAATGACCGGCCAGGGG pLX_317 48.5% 65.7% 45.8% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_07001 pDONR223 100% 65.5% 45.8% None (many diffs) n/a
10 ccsbBroad304_07001 pLX_304 0% 65.5% 45.8% V5 (many diffs) n/a
11 TRCN0000479224 GCACGATTCGGCACCAGTAAATTC pLX_317 64.8% 65.2% 45.4% V5 (many diffs) n/a
12 ccsbBroadEn_02358 pDONR223 100% 65.5% 44.4% None (many diffs) n/a
13 ccsbBroad304_02358 pLX_304 0% 65.5% 44.4% V5 (many diffs) n/a
14 TRCN0000472750 CCACTTCCGTACTCCCCGCTCGCG pLX_317 74.7% 65.5% 44.4% V5 (many diffs) n/a
15 ccsbBroadEn_01604 pDONR223 100% 65.3% 42.6% None (many diffs) n/a
16 ccsbBroad304_01604 pLX_304 0% 65.3% 42.6% V5 (many diffs) n/a
17 TRCN0000467573 GAGGTGCGGTAGTGGCTGTCGGAC pLX_317 86% 65.3% 42.6% V5 (many diffs) n/a
18 ccsbBroadEn_07002 pDONR223 100% 54.1% 41.1% None (many diffs) n/a
19 ccsbBroad304_07002 pLX_304 0% 54.1% 41.1% V5 (many diffs) n/a
20 TRCN0000470951 GTCCCTCCTCTCTTCTGCAACACA pLX_317 67.7% 54.1% 41.1% V5 (many diffs) n/a
Download CSV