Transcript: Human NR_003504.3

Homo sapiens GUSB pseudogene 2 (GUSBP2), non-coding RNA.

Source:
NCBI, updated 2019-01-23
Taxon:
Homo sapiens (human)
Gene:
GUSBP2 (387036)
Length:
1200
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003504.3
NBCI Gene record:
GUSBP2 (387036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003504.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147118 CCAGTTTGAGAATTGGTGTAA pLKO.1 762 3UTR 100% 4.950 2.475 Y GUSBP1 n/a
2 TRCN0000063784 CTACTCTTGGTATCGCAACTA pLKO.1 705 3UTR 100% 4.950 2.475 Y GUSBP14 n/a
3 TRCN0000063785 GATCCGTGTGAACAGCTACTA pLKO.1 687 3UTR 100% 4.950 2.475 Y GUSBP14 n/a
4 TRCN0000140371 GATCCGTGTGAACAGCTACTA pLKO.1 687 3UTR 100% 4.950 2.475 Y GUSBP15 n/a
5 TRCN0000155518 GATCCGTGTGAACAGCTACTA pLKO.1 687 3UTR 100% 4.950 2.475 Y GUSBP2 n/a
6 TRCN0000140881 GATCTCCGTCAAGTGCAGTAA pLKO.1 413 3UTR 100% 4.950 2.475 Y GUSBP15 n/a
7 TRCN0000155455 GATCTCCGTCAAGTGCAGTAA pLKO.1 413 3UTR 100% 4.950 2.475 Y GUSBP2 n/a
8 TRCN0000063787 TCAAGTTGGAAGTGTGTCTTT pLKO.1 439 3UTR 100% 4.950 2.475 Y GUSBP14 n/a
9 TRCN0000083212 TGTGGATGTGATCCGTGTGAA pLKO.1 678 3UTR 100% 4.950 2.475 Y GUSBP14 n/a
10 TRCN0000083208 CCCATTATTCAGAGCGCGTAT pLKO.1 794 3UTR 100% 4.050 2.025 Y GUSBP14 n/a
11 TRCN0000180084 CCCATTATTCAGAGCGCGTAT pLKO.1 794 3UTR 100% 4.050 2.025 Y GUSBP1 n/a
12 TRCN0000155750 CGTATGGAGTGGAAACGCTTA pLKO.1 810 3UTR 100% 4.050 2.025 Y GUSBP2 n/a
13 TRCN0000063783 CGTCAAGTGCAGTAACCAGTT pLKO.1 419 3UTR 100% 4.050 2.025 Y GUSBP14 n/a
14 TRCN0000139416 CGTCAAGTGCAGTAACCAGTT pLKO.1 419 3UTR 100% 4.050 2.025 Y GUSBP15 n/a
15 TRCN0000155992 CGTCAAGTGCAGTAACCAGTT pLKO.1 419 3UTR 100% 4.050 2.025 Y GUSBP2 n/a
16 TRCN0000141828 GAATTACCAGATCTCCGTCAA pLKO.1 404 3UTR 100% 4.050 2.025 Y GUSBP15 n/a
17 TRCN0000147980 GTAAGACATCACAATCCCATT pLKO.1 779 3UTR 100% 4.050 2.025 Y GUSBP1 n/a
18 TRCN0000151124 GTAAGACATCACAATCCCATT pLKO.1 779 3UTR 100% 4.050 2.025 Y GUSBP2 n/a
19 TRCN0000139692 CGTGTGAACAGCTACTACTCT pLKO.1 691 3UTR 100% 3.000 1.500 Y GUSBP15 n/a
20 TRCN0000142395 GAACAGCTACTACTCTTGGTA pLKO.1 696 3UTR 100% 3.000 1.500 Y GUSBP15 n/a
21 TRCN0000063786 GATTGCTCACACCAAAGCCTT pLKO.1 591 3UTR 100% 2.640 1.320 Y GUSBP14 n/a
22 TRCN0000140607 GATTGCTCACACCAAAGCCTT pLKO.1 591 3UTR 100% 2.640 1.320 Y GUSBP15 n/a
23 TRCN0000155293 GATTGCTCACACCAAAGCCTT pLKO.1 591 3UTR 100% 2.640 1.320 Y GUSBP2 n/a
24 TRCN0000139985 GCTACTACTCTTGGTATCGCA pLKO.1 701 3UTR 100% 0.750 0.375 Y GUSBP15 n/a
25 TRCN0000083210 CAGGCTGGTGAATTACCAGAT pLKO.1 395 3UTR 100% 0.405 0.203 Y GUSBP14 n/a
26 TRCN0000156066 CAGGCTGGTGAATTACCAGAT pLKO.1 395 3UTR 100% 0.405 0.203 Y GUSBP2 n/a
27 TRCN0000083211 GATGGTGATTGCTCACACCAA pLKO.1 585 3UTR 100% 0.264 0.132 Y GUSBP14 n/a
28 TRCN0000140710 GATGGTGATTGCTCACACCAA pLKO.1 585 3UTR 100% 0.264 0.132 Y GUSBP15 n/a
29 TRCN0000154457 GATGGTGATTGCTCACACCAA pLKO.1 585 3UTR 100% 0.264 0.132 Y GUSBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003504.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10363 pDONR223 100% 34.9% None 1_347del;757C>G;768_1200del n/a
2 ccsbBroad304_10363 pLX_304 0% 34.9% V5 1_347del;757C>G;768_1200del n/a
3 TRCN0000468935 ACAAATCCACAGGGATACGTAGGA pLX_317 82.2% 34.9% V5 1_347del;757C>G;768_1200del n/a
4 TRCN0000480097 CCTACCAATTATGTCCTACTGCCC pLX_317 90.5% 34.9% V5 1_347del;757C>G;768_1200del n/a
5 TRCN0000465895 CCTGACATAGAGGTGGGACTACAG pLX_317 77.6% 34.9% V5 1_347del;757C>G;768_1200del n/a
6 ccsbBroadEn_14986 pDONR223 97.2% 34.7% None (many diffs) n/a
7 ccsbBroad304_14986 pLX_304 0% 34.7% V5 (many diffs) n/a
8 ccsbBroadEn_13642 pDONR223 100% 23.1% None 1_585del;757C>G;865_1200del n/a
9 ccsbBroad304_13642 pLX_304 0% 23.1% V5 1_585del;757C>G;865_1200del n/a
10 TRCN0000466500 GCTTTGTGTAGGTATACCCTTCGC pLX_317 100% 23.1% V5 1_585del;757C>G;865_1200del n/a
11 ccsbBroadEn_13733 pDONR223 100% 23% None (many diffs) n/a
12 ccsbBroad304_13733 pLX_304 0% 23% V5 (many diffs) n/a
13 TRCN0000466397 GCGGGGGCGTGTGCCAGAGAATTC pLX_317 100% 23% V5 (many diffs) n/a
14 ccsbBroadEn_10410 pDONR223 100% 21.7% None (many diffs) n/a
15 ccsbBroad304_10410 pLX_304 0% 21.7% V5 (many diffs) n/a
16 TRCN0000468931 TTGATACAAGTTGGTTCCTGGCAG pLX_317 100% 21.7% V5 (many diffs) n/a
Download CSV