Transcript: Human NR_037688.3

Homo sapiens actin gamma 1 (ACTG1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ACTG1 (71)
Length:
1770
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037688.3
NBCI Gene record:
ACTG1 (71)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037688.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029474 GCTGGCAAGAACCAGTTGTTT pLKO.1 1456 3UTR 100% 5.625 7.875 N ACTG1 n/a
2 TRCN0000293291 GCTGGCAAGAACCAGTTGTTT pLKO_005 1456 3UTR 100% 5.625 7.875 N ACTG1 n/a
3 TRCN0000293359 TCTAAACGGACTCAGCAGATG pLKO_005 1196 3UTR 100% 4.050 3.240 N ACTG1 n/a
4 TRCN0000029475 CCGAGCCGTGTTTCCTTCCAT pLKO.1 153 3UTR 100% 1.000 0.700 N ACTG1 n/a
5 TRCN0000293290 CCGAGCCGTGTTTCCTTCCAT pLKO_005 153 3UTR 100% 1.000 0.700 N ACTG1 n/a
6 TRCN0000029478 CGCATCCTCCTCTTCTCTGGA pLKO.1 762 3UTR 100% 0.880 0.616 N ACTG1 n/a
7 TRCN0000029477 GCGTGGCATCCTGACCCTGAA pLKO.1 255 3UTR 100% 0.000 0.000 N ACTG1 n/a
8 TRCN0000293292 GGCATTGTCATGGACTCTGGA pLKO_005 520 3UTR 100% 2.640 1.584 N ACTG1 n/a
9 TRCN0000029476 CCAGCAGATGTGGATTAGCAA pLKO.1 1128 3UTR 100% 3.000 1.500 Y ACTG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037688.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15351 pDONR223 0% 63.5% None 1_72del;990C>T;1198_1770del n/a
2 ccsbBroad304_15351 pLX_304 0% 63.5% V5 1_72del;990C>T;1198_1770del n/a
3 ccsbBroadEn_13808 pDONR223 100% 63.5% None 1_72del;1193delG;1198_1770del n/a
4 ccsbBroad304_13808 pLX_304 0% 63.5% V5 (not translated due to frame shift) 1_72del;1193delG;1198_1770del n/a
5 TRCN0000471742 AATGGGAGTTCTCACGTCAGGTCC pLX_317 44.8% 63.5% V5 (not translated due to frame shift) 1_72del;1193delG;1198_1770del n/a
6 ccsbBroadEn_05764 pDONR223 100% 63.4% None (many diffs) n/a
7 ccsbBroad304_05764 pLX_304 0% 63.4% V5 (many diffs) n/a
8 TRCN0000466781 AATTGTGGTGCTTGTTGCCGCCTG pLX_317 31.7% 63.4% V5 (many diffs) n/a
9 ccsbBroadEn_05763 pDONR223 100% 57.9% None (many diffs) n/a
10 ccsbBroad304_05763 pLX_304 53.1% 57.9% V5 (many diffs) n/a
11 TRCN0000470279 TCAAGCCTGGAACGGGCTCACGTC pLX_317 31.7% 57.9% V5 (many diffs) n/a
12 ccsbBroadEn_13807 pDONR223 100% 54.6% None (many diffs) n/a
13 ccsbBroad304_13807 pLX_304 0% 54.6% V5 (not translated due to prior stop codon) (many diffs) n/a
14 TRCN0000475388 CAGGCCGACAGAGACACGAAATCC pLX_317 29.9% 54.6% V5 (not translated due to prior stop codon) (many diffs) n/a
15 ccsbBroadEn_14514 pDONR223 100% 31.7% None (many diffs) n/a
16 ccsbBroad304_14514 pLX_304 0% 31.7% V5 (not translated due to frame shift) (many diffs) n/a
17 TRCN0000481436 GCTCGTTTACTAGTATTTTTAATC pLX_317 64.2% 31.7% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV